Transcript: Human NM_178356.3

Homo sapiens late cornified envelope 4A (LCE4A), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
LCE4A (199834)
Length:
388
CDS:
30..329

Additional Resources:

NCBI RefSeq record:
NM_178356.3
NBCI Gene record:
LCE4A (199834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244813 ATCCTCATGCCCACCTCCAAT pLKO_005 119 CDS 100% 4.950 3.465 N LCE4A n/a
2 TRCN0000244815 ATGTCCCTCAAAGTGTGCATC pLKO_005 101 CDS 100% 4.050 2.835 N LCE4A n/a
3 TRCN0000244816 ACAGACACCATAGGTCCCACT pLKO_005 217 CDS 100% 2.160 1.512 N LCE4A n/a
4 TRCN0000244814 CAAAGTGTGCATCCTCATGCC pLKO_005 109 CDS 100% 2.160 1.512 N LCE4A n/a
5 TRCN0000244812 TGAGCCACCACAGACACCATA pLKO_005 208 CDS 100% 4.950 2.970 N LCE4A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178356.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05181 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05181 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479588 GAGCCCTGGCCTAATACTACATTC pLX_317 100% 100% 100% V5 n/a
4 ccsbBroadEn_05520 pDONR223 100% 62.5% 60.4% None (many diffs) n/a
5 ccsbBroad304_05520 pLX_304 0% 62.5% 60.4% V5 (many diffs) n/a
6 TRCN0000473334 TCTCCACCCTGTCCCCAATCTTTT pLX_317 100% 62.5% 60.4% V5 (many diffs) n/a
Download CSV