Transcript: Human NM_178429.3

Homo sapiens late cornified envelope 2C (LCE2C), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
LCE2C (353140)
Length:
594
CDS:
36..368

Additional Resources:

NCBI RefSeq record:
NM_178429.3
NBCI Gene record:
LCE2C (353140)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242460 CGGCCTGATGGATACTCTTTC pLKO_005 417 3UTR 100% 10.800 7.560 N LCE2C n/a
2 TRCN0000180868 GAAGAGCTCTTGGGACTGAAT pLKO.1 380 3UTR 100% 4.950 3.465 N LCE2C n/a
3 TRCN0000242459 GACTGAATGGCCAAGAACCTG pLKO_005 393 3UTR 100% 2.640 1.848 N LCE2C n/a
4 TRCN0000242458 AGAAGAGCTCTTGGGACTGAA pLKO_005 379 3UTR 100% 4.950 2.970 N LCE2C n/a
5 TRCN0000242456 TGGGCTACAGAAGAGCTCTTG pLKO_005 371 3UTR 100% 4.050 2.430 N LCE2C n/a
6 TRCN0000242457 ACCTGCTACGGCCTGATGGAT pLKO_005 409 3UTR 100% 1.000 0.600 N LCE2C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178429.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15312 pDONR223 57.5% 97.8% 96.3% None (many diffs) n/a
2 ccsbBroad304_15312 pLX_304 0% 97.8% 96.3% V5 (many diffs) n/a
3 ccsbBroadEn_15311 pDONR223 68% 86.6% 84.5% None (many diffs) n/a
4 ccsbBroad304_15311 pLX_304 0% 86.6% 84.5% V5 (many diffs) n/a
5 TRCN0000472237 AATCACACCAAATATCAACTATAT pLX_317 100% 42.4% 43.6% V5 (many diffs) n/a
Download CSV