Transcript: Human NM_178430.4

Homo sapiens late cornified envelope 2D (LCE2D), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
LCE2D (353141)
Length:
625
CDS:
72..404

Additional Resources:

NCBI RefSeq record:
NM_178430.4
NBCI Gene record:
LCE2D (353141)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245531 ACAGCCTGATGCTTAACTATT pLKO_005 451 3UTR 100% 13.200 9.240 N LCE2D n/a
2 TRCN0000245530 GAAGAGCTCTGGTACTGAATG pLKO_005 416 3UTR 100% 10.800 7.560 N LCE2D n/a
3 TRCN0000181147 CCAAATGTCCTCCCAAGTGTA pLKO.1 112 CDS 100% 4.950 2.970 N LCE2D n/a
4 TRCN0000245534 CCAAATGTCCTCCCAAGTGTA pLKO_005 112 CDS 100% 4.950 2.970 N LCE2D n/a
5 TRCN0000245532 CCCGATTGCTGTGAGAGTGAA pLKO_005 336 CDS 100% 4.950 2.970 N LCE2D n/a
6 TRCN0000180310 CCCTTCCTTTCATTCCACTCA pLKO.1 474 3UTR 100% 2.640 1.584 N LCE2D n/a
7 TRCN0000245533 CCCTTCCTTTCATTCCACTCA pLKO_005 474 3UTR 100% 2.640 1.584 N LCE2D n/a
8 TRCN0000179994 CTACAGCCTGATGCTTAACTA pLKO.1 449 3UTR 100% 5.625 2.813 Y LCE2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178430.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15312 pDONR223 57.5% 100% 100% None n/a
2 ccsbBroad304_15312 pLX_304 0% 100% 100% V5 n/a
3 ccsbBroadEn_15311 pDONR223 68% 87.5% 85.4% None (many diffs) n/a
4 ccsbBroad304_15311 pLX_304 0% 87.5% 85.4% V5 (many diffs) n/a
5 TRCN0000472237 AATCACACCAAATATCAACTATAT pLX_317 100% 41.8% 43.6% V5 (many diffs) n/a
Download CSV