Transcript: Human NM_178582.3

Homo sapiens histocompatibility minor 13 (HM13), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
HM13 (81502)
Length:
3947
CDS:
111..542

Additional Resources:

NCBI RefSeq record:
NM_178582.3
NBCI Gene record:
HM13 (81502)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073752 GCTTCAGACATGCCTGAAACA pLKO.1 297 CDS 100% 0.495 0.347 N HM13 n/a
2 TRCN0000289304 GCTTCAGACATGCCTGAAACA pLKO_005 297 CDS 100% 0.495 0.347 N HM13 n/a
3 TRCN0000030529 CCAGGAGTACATCAACCTCTT pLKO.1 401 CDS 100% 4.050 2.835 N H13 n/a
4 TRCN0000297555 CCAGGAGTACATCAACCTCTT pLKO_005 401 CDS 100% 4.050 2.835 N H13 n/a
5 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1748 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178582.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04234 pDONR223 100% 35.3% 33.3% None (many diffs) n/a
2 ccsbBroad304_04234 pLX_304 0% 35.3% 33.3% V5 (many diffs) n/a
3 TRCN0000470515 TAATGTGCCTTCAAACGGCCTTCC pLX_317 37.9% 35.3% 33.3% V5 (many diffs) n/a
4 TRCN0000488993 TTATAGCGGGGCCCCGTCGCTGGC pLX_317 30.2% 35.3% 33.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000492118 TAGAATGGAGCGGACGGCAGTAGG pLX_317 31.7% 35.3% 33.2% V5 (many diffs) n/a
Download CSV