Transcript: Mouse NM_178614.4

Mus musculus SAMM50 sorting and assembly machinery component (Samm50), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Samm50 (68653)
Length:
1673
CDS:
132..1541

Additional Resources:

NCBI RefSeq record:
NM_178614.4
NBCI Gene record:
Samm50 (68653)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197909 GAGAAATTTCTCCGTAAACTT pLKO.1 686 CDS 100% 5.625 7.875 N Samm50 n/a
2 TRCN0000376134 CCACGAGTGTCCGAGGATTTA pLKO_005 1156 CDS 100% 13.200 10.560 N Samm50 n/a
3 TRCN0000177570 CGACTCTCGAAATTCATCTAT pLKO.1 923 CDS 100% 5.625 4.500 N Samm50 n/a
4 TRCN0000297672 CGACTCTCGAAATTCATCTAT pLKO_005 923 CDS 100% 5.625 4.500 N Samm50 n/a
5 TRCN0000279569 ACCTGTGCAACCTCAACTATG pLKO_005 1333 CDS 100% 10.800 7.560 N Samm50 n/a
6 TRCN0000279560 CGAGAGAAATTTCTCCGTAAA pLKO_005 683 CDS 100% 10.800 7.560 N Samm50 n/a
7 TRCN0000216854 GCTTCATCAAGGAAGACTTTG pLKO.1 1012 CDS 100% 10.800 7.560 N Samm50 n/a
8 TRCN0000376038 GGAGAGGTCTTTAAGGCTAAA pLKO_005 333 CDS 100% 10.800 7.560 N Samm50 n/a
9 TRCN0000376073 GTATGGTACTCGGCCTCAAAC pLKO_005 556 CDS 100% 10.800 7.560 N Samm50 n/a
10 TRCN0000177457 CTCTCGAAATTCATCTATCTT pLKO.1 926 CDS 100% 5.625 3.938 N Samm50 n/a
11 TRCN0000182538 GTGGTGGTTCAGCATGTTCAT pLKO.1 264 CDS 100% 4.950 3.465 N Samm50 n/a
12 TRCN0000346083 GTGGTGGTTCAGCATGTTCAT pLKO_005 264 CDS 100% 4.950 3.465 N Samm50 n/a
13 TRCN0000200111 CCAATGGGTTAGATGTCACCT pLKO.1 469 CDS 100% 2.640 1.848 N Samm50 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178614.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15771 pDONR223 0% 85.2% 96.1% None (many diffs) n/a
2 ccsbBroad304_15771 pLX_304 0% 85.2% 96.1% V5 (many diffs) n/a
3 TRCN0000474473 TTGCTCCGACCCTCTAATGTAGCA pLX_317 41.4% 85.2% 96.1% V5 (many diffs) n/a
4 ccsbBroadEn_07946 pDONR223 100% 85% 95.9% None (many diffs) n/a
5 ccsbBroad304_07946 pLX_304 0% 85% 95.9% V5 (many diffs) n/a
6 TRCN0000468892 TCGAACATGGCGCCTAAATATTAG pLX_317 32.2% 85% 95.9% V5 (many diffs) n/a
Download CSV