Transcript: Mouse NM_178624.6

Mus musculus F-box and leucine-rich repeat protein 2 (Fbxl2), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fbxl2 (72179)
Length:
3203
CDS:
57..1328

Additional Resources:

NCBI RefSeq record:
NM_178624.6
NBCI Gene record:
Fbxl2 (72179)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178624.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092669 GCCGGAACATTGAACATTTAA pLKO.1 364 CDS 100% 15.000 21.000 N Fbxl2 n/a
2 TRCN0000437561 ATCACTGACAGCACGTGTTAC pLKO_005 405 CDS 100% 10.800 8.640 N Fbxl2 n/a
3 TRCN0000443607 TACACTGCTAGCTCGGAATTG pLKO_005 890 CDS 100% 10.800 8.640 N Fbxl2 n/a
4 TRCN0000424391 TGGTAATGCTATTCACCTTAA pLKO_005 1461 3UTR 100% 10.800 7.560 N Fbxl2 n/a
5 TRCN0000092668 CCCAACCACAACTGCAAGAAA pLKO.1 2392 3UTR 100% 5.625 3.938 N Fbxl2 n/a
6 TRCN0000092672 CAGATCACAAAGGAAGGCATT pLKO.1 558 CDS 100% 4.050 2.835 N Fbxl2 n/a
7 TRCN0000092670 CCTTGAAGAATGTGTCCTGAT pLKO.1 932 CDS 100% 4.050 2.835 N Fbxl2 n/a
8 TRCN0000092671 CCTTAGCAGATTCTGTTCCAA pLKO.1 428 CDS 100% 3.000 2.100 N Fbxl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178624.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02865 pDONR223 100% 87.9% 95.9% None (many diffs) n/a
2 ccsbBroad304_02865 pLX_304 0% 87.9% 95.9% V5 (many diffs) n/a
3 TRCN0000480745 CATTCGACCGAATATATATCTGAC pLX_317 31.4% 87.9% 95.9% V5 (many diffs) n/a
Download CSV