Construct: ORF TRCN0000480745
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF000026.2_s317c1
- Derived from:
- ccsbBroadEn_02865
- DNA Barcode:
- CATTCGACCGAATATATATCTGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- FBXL2 (25827)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000480745
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_012157.5 | 100% | 100% | |
2 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349316.2 | 93.1% | 93.1% | 951_1043del |
3 | human | 25827 | FBXL2 | F-box and leucine rich repe... | XM_024453440.1 | 93.1% | 93.1% | 951_1043del |
4 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349322.2 | 78.3% | 77.5% | (many diffs) |
5 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349323.1 | 72.5% | 71.2% | 0_1ins334;23_41del |
6 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349324.2 | 72.5% | 71.2% | 0_1ins334;23_41del |
7 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349325.2 | 72.5% | 71.2% | 0_1ins334;23_41del |
8 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349326.2 | 72.5% | 71.2% | 0_1ins334;23_41del |
9 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349319.1 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
10 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349320.2 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
11 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NM_001349321.2 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
12 | human | 25827 | FBXL2 | F-box and leucine rich repe... | XM_005265015.3 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
13 | human | 25827 | FBXL2 | F-box and leucine rich repe... | XM_011533559.2 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
14 | human | 25827 | FBXL2 | F-box and leucine rich repe... | XM_017006093.1 | 67.7% | 66.4% | 0_1ins334;23_41del;636_728del |
15 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146127.1 | 66.1% | 1_97del;1367_1918del | |
16 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146125.1 | 63% | 1_97del;162_255del;1461_2012del | |
17 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146124.1 | 62.5% | (many diffs) | |
18 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146129.1 | 60.2% | (many diffs) | |
19 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146128.1 | 54.4% | 1_97del;162_163ins225;1142_1693del | |
20 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146132.2 | 52% | 1_71del;1341_2438del | |
21 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146123.2 | 50.1% | 1_71del;136_229del;1435_2532del | |
22 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146121.1 | 42.2% | 1_71delinsAT;1339_2998del | |
23 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146122.1 | 40.9% | 1_71delinsAT;134_227del;1433_3092del | |
24 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146133.2 | 32.7% | 1_71del;137_186del;1391_3877del | |
25 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146126.2 | 32.4% | 1_71del;137_214del;1419_3905del | |
26 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146135.2 | 32.4% | 1_71del;135_221del;1428_3914del | |
27 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146131.2 | 32.3% | 1_71del;136_229del;1435_3921del | |
28 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146134.2 | 31.6% | (many diffs) | |
29 | human | 25827 | FBXL2 | F-box and leucine rich repe... | NR_146130.2 | 31% | (many diffs) | |
30 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | NM_178624.6 | 87.9% | 95.9% | (many diffs) |
31 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XR_379880.3 | 71% | (many diffs) | |
32 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XR_379879.2 | 65.2% | (many diffs) | |
33 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XR_379878.3 | 64.1% | (many diffs) | |
34 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XM_011243027.1 | 63.8% | 69% | (many diffs) |
35 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XM_011243028.2 | 63.8% | 69% | (many diffs) |
36 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XM_006512295.2 | 63.4% | 68.5% | (many diffs) |
37 | mouse | 72179 | Fbxl2 | F-box and leucine-rich repe... | XM_006512294.3 | 63.1% | 69% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1335
- ORF length:
- 1269
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt tttctcaaac aatgatgaag gccttattaa caaaaagtta cccaaagaac 121 ttctgttaag aatattttcc ttcttggata tagtaacttt gtgccgatgt gcacagattt 181 ccaaggcttg gaacatctta gccctggatg gaagcaactg gcaaagaata gatcttttta 241 actttcaaac agatgtagag ggtcgagtgg tggaaaatat ctcgaagcga tgcggtggat 301 tcctgaggaa gctcagcttg cgaggctgca ttggtgttgg ggattcctcc ttgaagacct 361 ttgcacagaa ctgccgaaac attgaacatt tgaacctcaa tggatgcaca aaaatcactg 421 acagcacgtg ttatagcctt agcagattct gttccaagct gaaacatctg gatctgacct 481 cctgtgtgtc tattacaaac agctccttga aggggatcag tgagggctgc cgaaacctgg 541 agtacctgaa cctctcttgg tgtgatcaga tcacgaagga tggcatcgag gcactggtgc 601 gaggttgtcg aggcctgaaa gccctgctcc tgaggggctg cacacagtta gaagatgaag 661 ctctgaaaca cattcagaat tactgccatg agcttgtgag cctcaacttg cagtcctgct 721 cacgtatcac ggatgaaggt gtggtgcaga tatgcagggg ctgtcaccgg ctacaggctc 781 tctgcctttc gggttgcagc aacctcacag atgcctctct tacagccctg ggtttgaact 841 gtccgcgact gcaaattttg gaggctgccc gatgctccca tttgactgac gcaggtttta 901 cacttttagc tcggaattgc cacgaattgg agaagatgga TCTTGAAGAA TGCATCCTGA 961 TAACCGACAG CACACTCATC CAGCTCTCCA TTCACTGTCC TAAACTGCAA GCCCTGAGCC 1021 TGTCCCACTG TGAACTCATC ACAGATGATG GGATCCTGCA CCTGAGCAAC AGTACCTGTG 1081 GCCATGAGAG GCTGCGGGTA CTGGAGTTGG ACAACTGCCT CCTCATCACT GATGTGGCCC 1141 TGGAACACCT AGAGAACTGC CGAGGCCTGG AGCGCCTCGA GCTGTACGAC TGCCAGCAGG 1201 TTACCCGTGC AGGCATCAAG CGGATGCGGG CTCAGCTCCC TCATGTCAAA GTCCACGCCT 1261 ACTTTGCTCC CGTCACCCCA CCGACAGCAG TGGCAGGAAG TGGACAGCGA CTGTGCAGGT 1321 GCTGTGTCAT TCTCTGCCCA ACTATCTTGT ACAAAGTGGT TGATATCGGT AAGCCTATCC 1381 CTAACCCTCT CCTCGGTCTC GATTCTACGT AGTAATGAAC TAGTCCGTAA CTTGAAAGTA 1441 TTTCGATTTC TTGGCTTTAT ATATCTTGTG GAAAGGACGA CATTCGACCG AATATATATC 1501 TGACACGCGT TAAGTCgaca atcaacctct ggattacaaa atttgtgaaa gatt