Transcript: Mouse NM_178626.3

Mus musculus CDC42 small effector 2 (Cdc42se2), mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Mus musculus (mouse)
Gene:
Cdc42se2 (72729)
Length:
3138
CDS:
558..812

Additional Resources:

NCBI RefSeq record:
NM_178626.3
NBCI Gene record:
Cdc42se2 (72729)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337561 CGACGGATTGACCGAAGTATG pLKO_005 621 CDS 100% 10.800 15.120 N Cdc42se2 n/a
2 TRCN0000184408 CCAACCAACTTTGTGCACACA pLKO.1 651 CDS 100% 2.640 2.112 N Cdc42se2 n/a
3 TRCN0000337558 CCAACCAACTTTGTGCACACA pLKO_005 651 CDS 100% 2.640 2.112 N Cdc42se2 n/a
4 TRCN0000216572 GAAAGCATTTCTCCTATATTT pLKO.1 2093 3UTR 100% 15.000 10.500 N Cdc42se2 n/a
5 TRCN0000337496 TAGGATCCGGAGACCTATTTA pLKO_005 679 CDS 100% 15.000 10.500 N Cdc42se2 n/a
6 TRCN0000183711 GCTGTAAATGTTCAGTGTATT pLKO.1 1478 3UTR 100% 13.200 9.240 N Cdc42se2 n/a
7 TRCN0000337560 GCTGTAAATGTTCAGTGTATT pLKO_005 1478 3UTR 100% 13.200 9.240 N Cdc42se2 n/a
8 TRCN0000184694 CCATTCAGAACCAGATGCAGT pLKO.1 721 CDS 100% 2.640 1.848 N Cdc42se2 n/a
9 TRCN0000195752 CGGAGACCTATTTAGTGGGAT pLKO.1 686 CDS 100% 2.640 1.848 N Cdc42se2 n/a
10 TRCN0000184315 GAAGTATGATCGGAGAGCCAA pLKO.1 634 CDS 100% 2.640 1.848 N Cdc42se2 n/a
11 TRCN0000215852 CTTATGATTTAACTGGTAAAC pLKO.1 1178 3UTR 100% 10.800 6.480 N Cdc42se2 n/a
12 TRCN0000184715 CAGCTCCATTCAGAACCAGAT pLKO.1 716 CDS 100% 4.050 2.430 N Cdc42se2 n/a
13 TRCN0000337559 CAGCTCCATTCAGAACCAGAT pLKO_005 716 CDS 100% 4.050 2.430 N Cdc42se2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178626.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03766 pDONR223 100% 90.8% 100% None (many diffs) n/a
2 ccsbBroad304_03766 pLX_304 0% 90.8% 100% V5 (many diffs) n/a
3 TRCN0000466294 TGCATTCGATCGACAGGTTTTAAA pLX_317 100% 90.8% 100% V5 (many diffs) n/a
Download CSV