Transcript: Mouse NM_178628.5

Mus musculus atlastin GTPase 1 (Atl1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Atl1 (73991)
Length:
2818
CDS:
395..2071

Additional Resources:

NCBI RefSeq record:
NM_178628.5
NBCI Gene record:
Atl1 (73991)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248668 ATCCGCTACTCTGGCGAATAT pLKO_005 1874 CDS 100% 13.200 18.480 N Atl1 n/a
2 TRCN0000248667 GAACTCTACATCCAGTATATT pLKO_005 1673 CDS 100% 15.000 10.500 N Atl1 n/a
3 TRCN0000255498 GTTCTACTACTGGGTTATAAT pLKO_005 2347 3UTR 100% 15.000 10.500 N Atl1 n/a
4 TRCN0000265648 GAGTCCTGAGCGTCTAGATAT pLKO_005 1309 CDS 100% 13.200 9.240 N Atl1 n/a
5 TRCN0000248666 TGGAGTTTCCCATACGAATTT pLKO_005 1049 CDS 100% 13.200 9.240 N Atl1 n/a
6 TRCN0000173631 GAAGCACAAATGAGGCGTTAT pLKO.1 1947 CDS 100% 10.800 7.560 N Atl1 n/a
7 TRCN0000176079 GATGAACTCTACATCCAGTAT pLKO.1 1670 CDS 100% 4.950 2.970 N Atl1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178628.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08206 pDONR223 100% 90.8% 96.5% None (many diffs) n/a
2 ccsbBroad304_08206 pLX_304 0% 90.8% 96.5% V5 (many diffs) n/a
3 TRCN0000471303 CATCCCTTTATTGTTACCTACTGC pLX_317 25.5% 90.8% 96.5% V5 (many diffs) n/a
Download CSV