Transcript: Mouse NM_178703.4

Mus musculus solute carrier family 6 (neurotransmitter transporter, GABA), member 1 (Slc6a1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Slc6a1 (232333)
Length:
4318
CDS:
380..2179

Additional Resources:

NCBI RefSeq record:
NM_178703.4
NBCI Gene record:
Slc6a1 (232333)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178703.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079835 CTACCTGATTGGCCTGTCTAA pLKO.1 1672 CDS 100% 4.950 6.930 N Slc6a1 n/a
2 TRCN0000079833 GCAGTGTATTTCATGTTTGTA pLKO.1 3829 3UTR 100% 5.625 4.500 N Slc6a1 n/a
3 TRCN0000079837 CCTACCTGATTGGCCTGTCTA pLKO.1 1671 CDS 100% 4.950 3.465 N Slc6a1 n/a
4 TRCN0000079834 CCTGGTCAATACCACCAACAT pLKO.1 913 CDS 100% 4.950 3.465 N Slc6a1 n/a
5 TRCN0000042875 CTTCTACATCACACCCAACTT pLKO.1 1186 CDS 100% 4.950 3.465 N SLC6A1 n/a
6 TRCN0000079836 CCTCTTCTACATCACACCCAA pLKO.1 1183 CDS 100% 2.640 1.848 N Slc6a1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178703.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06961 pDONR223 100% 90% 97.8% None (many diffs) n/a
2 ccsbBroad304_06961 pLX_304 0% 90% 97.8% V5 (many diffs) n/a
3 TRCN0000473919 GCATGACATGTAAACATCTAAATG pLX_317 23.6% 90% 97.8% V5 (many diffs) n/a
Download CSV