Transcript: Mouse NM_178939.2

Mus musculus p53 and DNA damage regulated 1 (Pdrg1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Pdrg1 (68559)
Length:
1229
CDS:
64..465

Additional Resources:

NCBI RefSeq record:
NM_178939.2
NBCI Gene record:
Pdrg1 (68559)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_178939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241113 TCAGCCCGGATGAGGTTAAAG pLKO_005 419 CDS 100% 13.200 18.480 N Pdrg1 n/a
2 TRCN0000241115 TGAAAGTTAACCGCCTCTTTG pLKO_005 353 CDS 100% 10.800 15.120 N Pdrg1 n/a
3 TRCN0000241117 AGGCTGCGGAGTCAACTTAAA pLKO_005 331 CDS 100% 13.200 10.560 N Pdrg1 n/a
4 TRCN0000217714 GATCAAGAGCACCTGGATAAA pLKO.1 301 CDS 100% 13.200 10.560 N Pdrg1 n/a
5 TRCN0000183847 CGGAGTCAACTTAAAGTGAAA pLKO.1 337 CDS 100% 4.950 3.960 N Pdrg1 n/a
6 TRCN0000241116 ATCAAGAGCACCTGGATAAAG pLKO_005 302 CDS 100% 13.200 9.240 N Pdrg1 n/a
7 TRCN0000241114 GCTTGGACACAAGACCTATTG pLKO_005 662 3UTR 100% 10.800 7.560 N Pdrg1 n/a
8 TRCN0000216701 CTCTGAAGATGTGATGGTTTG pLKO.1 222 CDS 100% 6.000 4.200 N Pdrg1 n/a
9 TRCN0000178975 CCCTAAGACGAAGGAAATGAT pLKO.1 273 CDS 100% 5.625 3.938 N Pdrg1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178939.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04241 pDONR223 100% 88.2% 91.7% None (many diffs) n/a
2 ccsbBroad304_04241 pLX_304 0% 88.2% 91.7% V5 (many diffs) n/a
3 TRCN0000468208 CGTGACCCGGCGCGCTCCCCGACT pLX_317 100% 88.2% 91.7% V5 (many diffs) n/a
Download CSV