Transcript: Human NM_181521.3

Homo sapiens CKLF like MARVEL transmembrane domain containing 4 (CMTM4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
CMTM4 (146223)
Length:
8153
CDS:
219..845

Additional Resources:

NCBI RefSeq record:
NM_181521.3
NBCI Gene record:
CMTM4 (146223)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122860 GCAGAAATTGCTGCCGTGATA pLKO.1 663 CDS 100% 4.950 6.930 N CMTM4 n/a
2 TRCN0000343192 GCAGAAATTGCTGCCGTGATA pLKO_005 663 CDS 100% 4.950 6.930 N CMTM4 n/a
3 TRCN0000144416 CAACTGGAATCTGACAGATTT pLKO.1 566 CDS 100% 13.200 9.240 N CMTM4 n/a
4 TRCN0000142470 GACTGGCGTCTTGCTGATTAT pLKO.1 509 CDS 100% 13.200 9.240 N CMTM4 n/a
5 TRCN0000141910 GCAGAGCACCAATGACTACAT pLKO.1 761 CDS 100% 4.950 3.465 N CMTM4 n/a
6 TRCN0000343194 GCAGAGCACCAATGACTACAT pLKO_005 761 CDS 100% 4.950 3.465 N CMTM4 n/a
7 TRCN0000121627 GCTGATTATGTTCAGTCTCAA pLKO.1 521 CDS 100% 4.950 3.465 N CMTM4 n/a
8 TRCN0000343191 GCTGATTATGTTCAGTCTCAA pLKO_005 521 CDS 100% 4.950 3.465 N CMTM4 n/a
9 TRCN0000144872 GAATCTGACAGATTTGGTCAA pLKO.1 572 CDS 100% 4.050 2.835 N CMTM4 n/a
10 TRCN0000143921 CCTGATTGCATTCATCTGCAT pLKO.1 413 CDS 100% 2.640 1.848 N CMTM4 n/a
11 TRCN0000142717 CGGCATATGCAGTGAACACAT pLKO.1 703 CDS 100% 0.000 0.000 N CMTM4 n/a
12 TRCN0000343193 CGGCATATGCAGTGAACACAT pLKO_005 703 CDS 100% 0.000 0.000 N CMTM4 n/a
13 TRCN0000126361 CCCAGATCAACTGGAATCTAA pLKO.1 559 CDS 100% 5.625 3.938 N Cmtm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181521.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04983 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04983 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000477858 GTCCAGCACCTCTTCTTATCTTAT pLX_317 71.8% 100% 100% V5 n/a
Download CSV