Transcript: Human NM_181659.3

Homo sapiens nuclear receptor coactivator 3 (NCOA3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Homo sapiens (human)
Gene:
NCOA3 (8202)
Length:
7961
CDS:
232..4506

Additional Resources:

NCBI RefSeq record:
NM_181659.3
NBCI Gene record:
NCOA3 (8202)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365196 TTCCACCTCCTAGGGATATAA pLKO_005 4755 3UTR 100% 15.000 21.000 N NCOA3 n/a
2 TRCN0000365253 CATTGCCTCTTCGGTCTAATA pLKO_005 3110 CDS 100% 13.200 18.480 N NCOA3 n/a
3 TRCN0000019699 GCCGCATTACTACAGGAGAAA pLKO.1 983 CDS 100% 4.950 6.930 N NCOA3 n/a
4 TRCN0000370320 GGATCAGAAGGCAGGATTATA pLKO_005 3543 CDS 100% 15.000 10.500 N NCOA3 n/a
5 TRCN0000370321 TGACACTGCACTAGGATTATT pLKO_005 4548 3UTR 100% 15.000 10.500 N NCOA3 n/a
6 TRCN0000365254 AGTAAGACAGATACGTCAAAT pLKO_005 456 CDS 100% 13.200 9.240 N NCOA3 n/a
7 TRCN0000377536 CTACAGGGCAGGGAGTTATTG pLKO_005 536 CDS 100% 13.200 9.240 N NCOA3 n/a
8 TRCN0000019701 CCTCCGCAACAGTTTCCATAT pLKO.1 4144 CDS 100% 10.800 7.560 N NCOA3 n/a
9 TRCN0000019702 CCTCTACATCTGGAGGAGTAT pLKO.1 2213 CDS 100% 4.950 3.465 N NCOA3 n/a
10 TRCN0000019703 GCAGTCTATTCGTCCTCCATA pLKO.1 2766 CDS 100% 4.950 3.465 N NCOA3 n/a
11 TRCN0000019700 CCATACATTTAATTGCCGTAT pLKO.1 807 CDS 100% 4.050 2.835 N NCOA3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181659.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01869 pDONR223 100% 99.7% 99.7% None 3635_3646del n/a
2 ccsbBroad304_01869 pLX_304 0% 99.7% 99.7% V5 3635_3646del n/a
3 TRCN0000475996 GAGAATCTGCTTATTCTACCCCCG pLX_317 8.6% 99.7% 99.7% V5 3635_3646del n/a
4 ccsbBroadEn_13991 pDONR223 100% 99.6% 85.2% None 3638A>C;3640_3652del n/a
5 ccsbBroad304_13991 pLX_304 0% 99.6% 85.2% V5 (not translated due to prior stop codon) 3638A>C;3640_3652del n/a
6 TRCN0000479279 CCGATTGTTCTGTATCCCATCTAA pLX_317 8.6% 99.6% 85.2% V5 (not translated due to prior stop codon) 3638A>C;3640_3652del n/a
Download CSV