Transcript: Human NM_181784.3

Homo sapiens sprouty related EVH1 domain containing 2 (SPRED2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
SPRED2 (200734)
Length:
4519
CDS:
613..1869

Additional Resources:

NCBI RefSeq record:
NM_181784.3
NBCI Gene record:
SPRED2 (200734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_181784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377586 ACGTGGACTCCTCAGACTTTG pLKO_005 1415 CDS 100% 10.800 15.120 N SPRED2 n/a
2 TRCN0000370470 GAGCAACCTACTCGGACAATC pLKO_005 1090 CDS 100% 10.800 15.120 N SPRED2 n/a
3 TRCN0000056828 GCAATCGAAGACCTTATAGAA pLKO.1 964 CDS 100% 5.625 7.875 N SPRED2 n/a
4 TRCN0000056830 CAGCTATATTGTGCGTGTCAA pLKO.1 642 CDS 100% 4.950 6.930 N SPRED2 n/a
5 TRCN0000365357 CACAGACTCCTGTACTATTAA pLKO_005 2126 3UTR 100% 15.000 12.000 N SPRED2 n/a
6 TRCN0000365424 ATCACTGGAAGGTCGATAATA pLKO_005 878 CDS 100% 15.000 10.500 N SPRED2 n/a
7 TRCN0000365356 CTGTGAGCACCGGAGGATTTA pLKO_005 1125 CDS 100% 13.200 9.240 N SPRED2 n/a
8 TRCN0000370471 AGCATCTGGTTCAGCGGAAAT pLKO_005 2329 3UTR 100% 10.800 7.560 N SPRED2 n/a
9 TRCN0000056832 CAACAGCTACAGACAGTTCTT pLKO.1 1049 CDS 100% 4.950 3.465 N SPRED2 n/a
10 TRCN0000056831 CCTCCGGTGGATGGCTCTTAT pLKO.1 1737 CDS 100% 4.400 3.080 N SPRED2 n/a
11 TRCN0000056829 AGAAAGACAAACTGGTGGTAT pLKO.1 803 CDS 100% 4.950 2.970 N SPRED2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181784.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05192 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05192 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476321 CTGGATCGCTCCCCTCCTTGCGCC pLX_317 30.4% 99.9% 99.7% V5 877T>C n/a
Download CSV