Transcript: Human NM_182762.4

Homo sapiens MET transcriptional regulator MACC1 (MACC1), mRNA.

Source:
NCBI, updated 2019-08-21
Taxon:
Homo sapiens (human)
Gene:
MACC1 (346389)
Length:
9153
CDS:
304..2862

Additional Resources:

NCBI RefSeq record:
NM_182762.4
NBCI Gene record:
MACC1 (346389)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_182762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000242546 GCGTGACTTAGGATAAGATTT pLKO_005 6260 3UTR 100% 13.200 18.480 N MACC1 n/a
2 TRCN0000242550 TCAAGGAGGGTCAGTACAATT pLKO_005 963 CDS 100% 13.200 18.480 N MACC1 n/a
3 TRCN0000242549 AGATCCTACTACACGACTTAG pLKO_005 788 CDS 100% 10.800 15.120 N MACC1 n/a
4 TRCN0000242548 CATTGAACTTTAGCAACTATG pLKO_005 1943 CDS 100% 10.800 15.120 N MACC1 n/a
5 TRCN0000168270 CTCAGAGGTAAGATTGGACTT pLKO.1 2107 CDS 100% 4.050 5.670 N MACC1 n/a
6 TRCN0000242547 TTCACCCTTCGTGGTAATAAT pLKO_005 460 CDS 100% 15.000 10.500 N MACC1 n/a
7 TRCN0000168589 GCTGTTGAGATGATGTGGAAA pLKO.1 2641 CDS 100% 4.950 3.465 N MACC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_182762.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05502 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05502 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000481393 CTCAAGAACGCAGCAGTACCGATG pLX_317 17.6% 100% 100% V5 n/a
Download CSV