Transcript: Human NM_183040.2

Homo sapiens dystrobrevin binding protein 1 (DTNBP1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
DTNBP1 (84062)
Length:
1963
CDS:
190..1101

Additional Resources:

NCBI RefSeq record:
NM_183040.2
NBCI Gene record:
DTNBP1 (84062)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083304 CCAGCTTTAATCGCAGACTTA pLKO.1 502 CDS 100% 4.950 6.930 N DTNBP1 n/a
2 TRCN0000379485 AGATGGACCTGATGGACATAT pLKO_005 908 CDS 100% 13.200 9.240 N DTNBP1 n/a
3 TRCN0000083305 CTGCTGGATTAGAATTACTTA pLKO.1 326 CDS 100% 5.625 3.938 N DTNBP1 n/a
4 TRCN0000083306 GAAACCTTCAAAGCTGAACTA pLKO.1 688 CDS 100% 4.950 3.465 N DTNBP1 n/a
5 TRCN0000215486 GAATTACTTAGCAGGTATGAG pLKO.1 337 CDS 100% 4.950 3.465 N Dtnbp1 n/a
6 TRCN0000083307 GCTGAAGACTTTAAGTGACAA pLKO.1 246 CDS 100% 4.950 3.465 N DTNBP1 n/a
7 TRCN0000380552 TGCTGCATCTGGAAGACTTAT pLKO_005 584 CDS 100% 13.200 7.920 N DTNBP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183040.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04321 pDONR223 100% 79.8% 78.9% None (many diffs) n/a
2 ccsbBroad304_04321 pLX_304 0% 79.8% 78.9% V5 (many diffs) n/a
3 TRCN0000471667 TTTCATTCTTTTATTCTGTCTATA pLX_317 38.9% 79.8% 78.9% V5 (many diffs) n/a
Download CSV