Transcript: Human NM_183078.3

Homo sapiens ring finger protein 8 (RNF8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
RNF8 (9025)
Length:
5411
CDS:
183..1529

Additional Resources:

NCBI RefSeq record:
NM_183078.3
NBCI Gene record:
RNF8 (9025)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293325 TACATGTCGAAAGAGTTATTT pLKO_005 1688 3UTR 100% 15.000 21.000 N RNF8 n/a
2 TRCN0000293324 TGGAACCTTTAAGGGTCTATT pLKO_005 457 CDS 100% 13.200 18.480 N RNF8 n/a
3 TRCN0000003440 CAAAGAATTAGAGCAGACCAA pLKO.1 1289 CDS 100% 2.640 3.696 N RNF8 n/a
4 TRCN0000003437 GCCTGAATGTACTATGTTTAA pLKO.1 3990 3UTR 100% 13.200 9.240 N RNF8 n/a
5 TRCN0000003441 CCAAAGAATGACCAAATGATA pLKO.1 594 CDS 100% 5.625 3.938 N RNF8 n/a
6 TRCN0000298501 CCAAAGAATGACCAAATGATA pLKO_005 594 CDS 100% 5.625 3.938 N RNF8 n/a
7 TRCN0000003438 TGGAGCAACTAGAGAAGACTT pLKO.1 1111 CDS 100% 4.950 3.465 N RNF8 n/a
8 TRCN0000293306 TGGAGCAACTAGAGAAGACTT pLKO_005 1111 CDS 100% 4.950 3.465 N RNF8 n/a
9 TRCN0000003439 GAAGCCGTTATGAATGTGAAA pLKO.1 984 CDS 100% 4.950 2.970 N RNF8 n/a
10 TRCN0000293390 GAAGCCGTTATGAATGTGAAA pLKO_005 984 CDS 100% 4.950 2.970 N RNF8 n/a
11 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 2513 3UTR 100% 4.950 2.475 Y n/a
12 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 2454 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183078.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07340 pDONR223 100% 88.9% 82.5% None (many diffs) n/a
2 ccsbBroad304_07340 pLX_304 0% 88.9% 82.5% V5 (many diffs) n/a
3 TRCN0000467155 CCCTCTGAGTGTACCATCTCGAAG pLX_317 25.9% 88.9% 82.5% V5 (many diffs) n/a
Download CSV