Transcript: Human NM_183230.3

Homo sapiens IKAROS family zinc finger 3 (IKZF3), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
IKZF3 (22806)
Length:
9671
CDS:
187..1599

Additional Resources:

NCBI RefSeq record:
NM_183230.3
NBCI Gene record:
IKZF3 (22806)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017591 CCACTGCTTTGATGTCAACTA pLKO.1 906 CDS 100% 4.950 6.930 N IKZF3 n/a
2 TRCN0000414188 GACAGTCTAAGAGTAAGTAAA pLKO_005 2078 3UTR 100% 13.200 10.560 N IKZF3 n/a
3 TRCN0000436593 ATCTAATCTCCCTAATCTAAA pLKO_005 2056 3UTR 100% 13.200 9.240 N IKZF3 n/a
4 TRCN0000414555 GTAACCTCCTCCGCCACATTA pLKO_005 662 CDS 100% 13.200 9.240 N IKZF3 n/a
5 TRCN0000017589 CGAGTGTAACATGTGTGGATA pLKO.1 1509 CDS 100% 4.950 3.465 N IKZF3 n/a
6 TRCN0000017590 GCCAATGAAGATGAAGACATA pLKO.1 325 CDS 100% 4.950 3.465 N IKZF3 n/a
7 TRCN0000017592 GCCTGAAATCCCTTACAGCTA pLKO.1 432 CDS 100% 2.640 1.848 N IKZF3 n/a
8 TRCN0000166201 CATGGTGAAACCCTGTCTCTA pLKO.1 3332 3UTR 100% 4.950 2.475 Y ORAI2 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6785 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000162985 GAGACAAGGTTTCACCATGTT pLKO.1 4669 3UTR 100% 4.950 2.475 Y LINC00336 n/a
11 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6786 3UTR 100% 13.200 6.600 Y LIAS n/a
12 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5571 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183230.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02684 pDONR223 100% 92.3% 92.3% None 707_708ins117 n/a
2 ccsbBroad304_02684 pLX_304 0% 92.3% 92.3% V5 707_708ins117 n/a
3 TRCN0000491596 GGATACATCCTATAATGTGCATTA pLX_317 27.1% 92.3% 92.3% V5 707_708ins117 n/a
Download CSV