Transcript: Human NM_183353.3

Homo sapiens ring finger protein, LIM domain interacting (RLIM), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
RLIM (51132)
Length:
10627
CDS:
289..2163

Additional Resources:

NCBI RefSeq record:
NM_183353.3
NBCI Gene record:
RLIM (51132)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_183353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004143 GCTCAGTCTCAAATCGAAATA pLKO.1 1577 CDS 100% 13.200 18.480 N RLIM n/a
2 TRCN0000004142 GCTGATATAGTGATGGGCAAA pLKO.1 2190 3UTR 100% 4.050 5.670 N RLIM n/a
3 TRCN0000427174 TCTGATTTCCGTACCAGTTAA pLKO_005 2373 3UTR 100% 13.200 9.240 N RLIM n/a
4 TRCN0000417217 CCCAGTCACATTTGATGAAAG pLKO_005 1836 CDS 100% 10.800 7.560 N RLIM n/a
5 TRCN0000432704 GTGATTAAAGCTATATCATTC pLKO_005 2577 3UTR 100% 10.800 7.560 N RLIM n/a
6 TRCN0000417735 AGACGGAGGGAAGTTCTAGAA pLKO_005 1061 CDS 100% 4.950 3.465 N RLIM n/a
7 TRCN0000004139 GTAAATAACCTGAGTGAAGAA pLKO.1 394 CDS 100% 4.950 3.465 N RLIM n/a
8 TRCN0000421712 TGGTGATTTCAGATTCAGTTT pLKO_005 684 CDS 100% 4.950 3.465 N RLIM n/a
9 TRCN0000432621 GCAAAGGAAATTACCAGTTTA pLKO_005 2529 3UTR 100% 13.200 7.920 N RLIM n/a
10 TRCN0000004140 GAATATACAGAAGGCAACAAA pLKO.1 2014 CDS 100% 5.625 3.375 N RLIM n/a
11 TRCN0000417274 CCTATGTCAGTACCATCAGAA pLKO_005 1418 CDS 100% 4.950 2.970 N RLIM n/a
12 TRCN0000004141 GAGATAGCATAGCCAGCAGAA pLKO.1 1295 CDS 100% 4.050 2.430 N RLIM n/a
13 TRCN0000074641 GCACCGTTCCACAGTATAAAT pLKO.1 10124 3UTR 100% 15.000 7.500 Y PABPC1 n/a
14 TRCN0000074639 CCGCACCGTTCCACAGTATAA pLKO.1 10122 3UTR 100% 13.200 6.600 Y PABPC1 n/a
15 TRCN0000298167 CCGCACCGTTCCACAGTATAA pLKO_005 10122 3UTR 100% 13.200 6.600 Y PABPC1 n/a
16 TRCN0000165027 GAACTCCTGACCTCAAGTGAT pLKO.1 5336 3UTR 100% 4.950 2.475 Y LOC387873 n/a
17 TRCN0000165534 GAGACAGGGTTTCACCATGTT pLKO.1 9724 3UTR 100% 4.950 2.475 Y n/a
18 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 5206 3UTR 100% 4.950 2.475 Y C16orf89 n/a
19 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 6624 3UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_183353.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03224 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_03224 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467295 ACCATCATGATTGCCCTGGGATGG pLX_317 17.1% 100% 100% V5 n/a
Download CSV