Transcript: Human NM_197972.2

Homo sapiens NME/NM23 family member 7 (NME7), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-09-23
Taxon:
Homo sapiens (human)
Gene:
NME7 (29922)
Length:
1625
CDS:
331..1353

Additional Resources:

NCBI RefSeq record:
NM_197972.2
NBCI Gene record:
NME7 (29922)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146300 ACTGGTATTAATTGACTATG pXPR_003 GGG 124 12% 3 0.3284 NME7 NME7 76497
2 BRDN0001145354 GGCATAAGAAATGCAGCGCA pXPR_003 TGG 506 49% 6 0.1874 NME7 NME7 76495
3 BRDN0001146186 GAGATGATGCTATATGTGAA pXPR_003 TGG 402 39% 6 0.0455 NME7 NME7 76494
4 BRDN0001148617 ACTTGAAAAAGGGTCTTGAC pXPR_003 TGG 317 31% 5 -0.0234 NME7 NME7 76496
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_197972.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000010222 GGATCAATATACAGCTCGCCA pLKO.1 459 CDS 100% 0.660 0.924 N NME7 n/a
2 TRCN0000342536 GGATCAATATACAGCTCGCCA pLKO_005 459 CDS 100% 0.660 0.924 N NME7 n/a
3 TRCN0000010221 GCTTCACTTCTTCGACGTTAT pLKO.1 274 5UTR 100% 10.800 7.560 N NME7 n/a
4 TRCN0000342476 GCTTCACTTCTTCGACGTTAT pLKO_005 274 5UTR 100% 10.800 7.560 N NME7 n/a
5 TRCN0000010223 GATGCTATATGTGAATGGAAA pLKO.1 721 CDS 100% 4.950 3.465 N NME7 n/a
6 TRCN0000342478 GATGCTATATGTGAATGGAAA pLKO_005 721 CDS 100% 4.950 3.465 N NME7 n/a
7 TRCN0000010225 GATCGGGTTAATGTTGAGGAA pLKO.1 1051 CDS 100% 2.640 1.848 N NME7 n/a
8 TRCN0000010224 CTGAAAGCATTAGAGCCCTCT pLKO.1 788 CDS 100% 2.160 1.512 N NME7 n/a
9 TRCN0000342538 CTGAAAGCATTAGAGCCCTCT pLKO_005 788 CDS 100% 2.160 1.512 N NME7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_197972.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000492222 TCGCCAAGGAAAGCTCCCAACTTA pLX_317 40.7% 90.3% 68.3% V5 (not translated due to prior stop codon) 0_1ins108;772G>T n/a
2 TRCN0000491534 GGAAATTTTTCTTCTCAGCGAGCA pLX_317 28.9% 90.3% 90.1% V5 0_1ins108;1020_1021insG n/a
3 ccsbBroadEn_15052 pDONR223 0% 90.3% 90.4% None 0_1ins108;99T>C n/a
4 ccsbBroad304_15052 pLX_304 45.1% 90.3% 90.4% V5 0_1ins108;99T>C n/a
5 TRCN0000481255 ACTCATTCTGAACGTGCAGCACGG pLX_317 36.6% 90.3% 90.4% V5 0_1ins108;99T>C n/a
6 TRCN0000489327 CGATATTTAACATCTACACACTGA pLX_317 29.2% 90.3% 90.4% V5 (not translated due to prior stop codon) 0_1ins108;99T>C n/a
Download CSV