Transcript: Human NM_198080.4

Homo sapiens methionine sulfoxide reductase B3 (MSRB3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
MSRB3 (253827)
Length:
4250
CDS:
87..665

Additional Resources:

NCBI RefSeq record:
NM_198080.4
NBCI Gene record:
MSRB3 (253827)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064760 ACTCCATTGTTTAAGTCAGAA pLKO.1 357 CDS 100% 4.950 6.930 N MSRB3 n/a
2 TRCN0000294008 TCCGGGTCGTGTAGGGATAAA pLKO_005 180 CDS 100% 13.200 17.160 N MSRB3 n/a
3 TRCN0000064761 CATTCCACGATGTGATCAATT pLKO.1 409 CDS 100% 13.200 10.560 N MSRB3 n/a
4 TRCN0000286589 CATTCCACGATGTGATCAATT pLKO_005 409 CDS 100% 13.200 10.560 N MSRB3 n/a
5 TRCN0000429388 CACAAAGATCCTGGAATATAT pLKO_005 318 CDS 100% 15.000 10.500 N Msrb3 n/a
6 TRCN0000294009 CAAGAACTGTTTATAGCTTTA pLKO_005 849 3UTR 100% 10.800 7.560 N MSRB3 n/a
7 TRCN0000298671 TCAGGAGAAAGGGACCGAAAG pLKO_005 272 CDS 100% 6.000 4.200 N MSRB3 n/a
8 TRCN0000064762 AGGAGAATACACACATCACAA pLKO.1 302 CDS 100% 4.950 3.465 N MSRB3 n/a
9 TRCN0000064759 GTGTTGTTTGTGGAACTCCAT pLKO.1 343 CDS 100% 2.640 1.848 N MSRB3 n/a
10 TRCN0000085621 GTACCATGTCACTCAGGAGAA pLKO.1 260 CDS 100% 0.000 0.000 N Msrb3 n/a
11 TRCN0000064758 CTGCATAAATTCGGCTGCCTT pLKO.1 557 CDS 100% 2.640 1.584 N MSRB3 n/a
12 TRCN0000082473 CTGTGTGACAAAGGACAAGCT pLKO.1 2215 3UTR 100% 2.640 1.848 N LOC390641 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198080.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05292 pDONR223 100% 86.8% 83.4% None (many diffs) n/a
2 ccsbBroad304_05292 pLX_304 0% 86.8% 83.4% V5 (many diffs) n/a
3 TRCN0000472383 AGTTTACATGTATCCGCCAGTTAC pLX_317 85.9% 86.8% 83.4% V5 (many diffs) n/a
Download CSV