Transcript: Human NM_198179.3

Homo sapiens pyroglutamylated RFamide peptide receptor (QRFPR), mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Homo sapiens (human)
Gene:
QRFPR (84109)
Length:
2339
CDS:
372..1667

Additional Resources:

NCBI RefSeq record:
NM_198179.3
NBCI Gene record:
QRFPR (84109)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000368524 GGTTCAGTGCTTCGAACTATT pLKO_005 1119 CDS 100% 13.200 18.480 N QRFPR n/a
2 TRCN0000014516 CGAAGGGCTTTCACAATGCTA pLKO.1 849 CDS 100% 3.000 2.400 N QRFPR n/a
3 TRCN0000358289 ACCAATTGATCACAATCATTT pLKO_005 1839 3UTR 100% 13.200 9.240 N QRFPR n/a
4 TRCN0000014514 CCTCTTATGGTGATGCTTATT pLKO.1 1047 CDS 100% 13.200 9.240 N QRFPR n/a
5 TRCN0000358288 TGCAACAACTTGAGATCAAAT pLKO_005 919 CDS 100% 13.200 9.240 N QRFPR n/a
6 TRCN0000014515 GCAGTTTGTTATTGCATAGTA pLKO.1 1407 CDS 100% 5.625 3.938 N QRFPR n/a
7 TRCN0000014517 GCTTCGAACTATTCATGGAAA pLKO.1 1127 CDS 100% 4.950 3.465 N QRFPR n/a
8 TRCN0000014513 GCTCCAGAACATTTCCGACAA pLKO.1 680 CDS 100% 4.050 2.835 N QRFPR n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 1948 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198179.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489301 CAGTTGCCCTAATCGCATATATCG pLX_317 24% 99.9% 100% V5 816C>T n/a
2 TRCN0000488019 GACCGTGCGAGCACTCACGAGTTA pLX_317 23.9% 99.9% 100% V5 (not translated due to prior stop codon) 816C>T n/a
3 TRCN0000488188 TCGGCTTGAATGCGCTTCAACACT pLX_317 13.2% 99.9% 99.7% V5 (not translated due to prior stop codon) 1181G>C n/a
4 ccsbBroadEn_12778 pDONR223 100% 82.4% 82.3% None 1_225del;654C>T;1031T>C n/a
5 ccsbBroad304_12778 pLX_304 0% 82.4% 82.3% V5 1_225del;654C>T;1031T>C n/a
6 TRCN0000475571 ACCAGAATCATGAAACTGATACCC pLX_317 28.7% 82.4% 82.3% V5 1_225del;654C>T;1031T>C n/a
Download CSV