Transcript: Human NM_198187.3

Homo sapiens astrotactin 2 (ASTN2), transcript variant 3, mRNA.

Source:
NCBI, updated 2018-11-18
Taxon:
Homo sapiens (human)
Gene:
ASTN2 (23245)
Length:
1820
CDS:
237..1445

Additional Resources:

NCBI RefSeq record:
NM_198187.3
NBCI Gene record:
ASTN2 (23245)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129549 GCACCACTACAACTCTCACTA pLKO.1 1103 CDS 100% 4.950 6.930 N ASTN2 n/a
2 TRCN0000129639 CAGTATCTACTCAGTCATCTT pLKO.1 839 CDS 100% 4.950 3.960 N ASTN2 n/a
3 TRCN0000426953 GTGAGGAAGCATGGGTCTTTA pLKO_005 1661 3UTR 100% 13.200 9.240 N ASTN2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198187.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15754 pDONR223 0% 98.2% 98.2% None 1152_1172del n/a
2 ccsbBroad304_15754 pLX_304 0% 98.2% 98.2% V5 1152_1172del n/a
3 TRCN0000473836 ATTGTGCGAGGCATCCGAGAACGT pLX_317 37.5% 98.2% 98.2% V5 1152_1172del n/a
4 ccsbBroadEn_07862 pDONR223 100% 86.5% 86.4% None 0_1ins147;1115C>T;1173_1206delinsG n/a
5 ccsbBroad304_07862 pLX_304 0% 86.5% 86.4% V5 0_1ins147;1115C>T;1173_1206delinsG n/a
6 TRCN0000467833 TAGGACATTCCAATACTGCTACGC pLX_317 35.2% 86.5% 86.4% V5 0_1ins147;1115C>T;1173_1206delinsG n/a
7 ccsbBroadEn_15753 pDONR223 0% 46.2% 42.9% None (many diffs) n/a
8 ccsbBroad304_15753 pLX_304 0% 46.2% 42.9% V5 (many diffs) n/a
9 TRCN0000474437 CTCTTTTGGGTTCCCTAAAGGGCG pLX_317 64.9% 46.2% 42.9% V5 (many diffs) n/a
Download CSV