Transcript: Human NM_198212.3

Homo sapiens caveolin 2 (CAV2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
CAV2 (858)
Length:
2765
CDS:
45..383

Additional Resources:

NCBI RefSeq record:
NM_198212.3
NBCI Gene record:
CAV2 (858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123019 GCACCACTGTTCTGTTCATTT pLKO.1 410 3UTR 100% 13.200 18.480 N CAV2 n/a
2 TRCN0000289002 GCACCACTGTTCTGTTCATTT pLKO_005 410 3UTR 100% 13.200 18.480 N CAV2 n/a
3 TRCN0000382118 TTCATGGACGACGACTCCTAC pLKO_005 81 CDS 100% 4.050 3.240 N CAV2 n/a
4 TRCN0000296146 CAACTGAGCCAGGATTGAATA pLKO_005 328 CDS 100% 13.200 9.240 N CAV2 n/a
5 TRCN0000382052 CAATATGGAAGAGTGTGACAG pLKO_005 248 CDS 100% 4.050 2.835 N CAV2 n/a
6 TRCN0000382262 TTCTGTCAGCCTGCAACTGAG pLKO_005 315 CDS 100% 4.050 2.835 N CAV2 n/a
7 TRCN0000380560 TACGAGCGTAGGACGATGCTT pLKO_005 291 CDS 100% 3.000 2.100 N CAV2 n/a
8 TRCN0000123023 CCGGCTCAACTCGCATCTCAA pLKO.1 173 CDS 100% 1.650 1.155 N CAV2 n/a
9 TRCN0000123020 GCAGACAATATGGAAGAGTGT pLKO.1 243 CDS 100% 2.640 1.584 N CAV2 n/a
10 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1800 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00227 pDONR223 100% 56.8% 38.2% None 149_150ins188;299_336del n/a
2 ccsbBroad304_00227 pLX_304 0% 56.8% 38.2% V5 149_150ins188;299_336del n/a
Download CSV