Transcript: Mouse NM_198415.2

Mus musculus creatine kinase, mitochondrial 2 (Ckmt2), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Ckmt2 (76722)
Length:
1516
CDS:
85..1344

Additional Resources:

NCBI RefSeq record:
NM_198415.2
NBCI Gene record:
Ckmt2 (76722)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360828 GAGATTCTGTCGTGGACTAAA pLKO_005 939 CDS 100% 13.200 18.480 N Ckmt2 n/a
2 TRCN0000360829 GGCAATATGAAACGCGTATTT pLKO_005 916 CDS 100% 13.200 18.480 N Ckmt2 n/a
3 TRCN0000360754 GGCAGATGTGTACGATATTTC pLKO_005 1176 CDS 100% 13.200 10.560 N Ckmt2 n/a
4 TRCN0000024568 CTAAAGGAAGTGGAACGATTA pLKO.1 955 CDS 100% 10.800 8.640 N Ckmt2 n/a
5 TRCN0000024565 GTGTACGATATTTCCAACATA pLKO.1 1183 CDS 100% 5.625 4.500 N Ckmt2 n/a
6 TRCN0000360755 ATGAGCGTCTGGGATACATTT pLKO_005 1007 CDS 100% 13.200 9.240 N Ckmt2 n/a
7 TRCN0000024566 CCACTGGTTACCTGCTGAATA pLKO.1 164 CDS 100% 13.200 9.240 N Ckmt2 n/a
8 TRCN0000024564 CCAGGGTGATCTCAATGGAAA pLKO.1 890 CDS 100% 4.950 3.465 N Ckmt2 n/a
9 TRCN0000196397 GACCACTTTCTGTTTGATAAG pLKO.1 754 CDS 100% 10.800 6.480 N CKMT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198415.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00315 pDONR223 100% 88.8% 95.9% None (many diffs) n/a
2 ccsbBroad304_00315 pLX_304 0% 88.8% 95.9% V5 (many diffs) n/a
3 TRCN0000491337 CAGTATGCTTATTATAATTAGTCT pLX_317 26.3% 88.8% 95.9% V5 (many diffs) n/a
4 ccsbBroadEn_14586 pDONR223 0% 88.8% 95.9% None (many diffs) n/a
5 ccsbBroad304_14586 pLX_304 0% 88.8% 95.9% V5 (many diffs) n/a
6 TRCN0000480045 GTCAGCAACGCCTGAAGGCTCGAC pLX_317 26.3% 88.8% 95.9% V5 (many diffs) n/a
Download CSV