Transcript: Mouse NM_198429.2

Mus musculus nuclear factor of activated T cells, cytoplasmic, calcineurin dependent 1 (Nfatc1), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Nfatc1 (18018)
Length:
4607
CDS:
306..2789

Additional Resources:

NCBI RefSeq record:
NM_198429.2
NBCI Gene record:
Nfatc1 (18018)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081927 CGACATCATATATGAGCCCAT pLKO.1 1519 CDS 100% 2.160 3.024 N Nfatc1 n/a
2 TRCN0000312781 CGGTAACACCACCCAGTATAC pLKO_005 1214 CDS 100% 10.800 8.640 N Nfatc1 n/a
3 TRCN0000312831 ACTCTGGAGAGTCCGAGAATC pLKO_005 651 CDS 100% 10.800 7.560 N Nfatc1 n/a
4 TRCN0000349759 GGTCAGTGTGACCGAAGATAC pLKO_005 1187 CDS 100% 10.800 7.560 N Nfatc1 n/a
5 TRCN0000081925 CCCGTCCAAGTCAGTTTCTAT pLKO.1 2319 CDS 100% 5.625 3.938 N Nfatc1 n/a
6 TRCN0000311848 CCCGTCCAAGTCAGTTTCTAT pLKO_005 2319 CDS 100% 5.625 3.938 N Nfatc1 n/a
7 TRCN0000081926 CTACACGGTTACTTGGAGAAT pLKO.1 1695 CDS 100% 4.950 3.465 N Nfatc1 n/a
8 TRCN0000347997 GAAGCTCAGAAACTCTGATAT pLKO_005 1919 CDS 100% 13.200 7.920 N Nfatc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198429.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06634 pDONR223 100% 71.3% 74.9% None (many diffs) n/a
2 ccsbBroad304_06634 pLX_304 0% 71.3% 74.9% V5 (many diffs) n/a
3 TRCN0000471213 GCCGAAGGAGTGCTTTTTACAGCG pLX_317 17.1% 71.3% 74.9% V5 (many diffs) n/a
4 ccsbBroadEn_06635 pDONR223 100% 71.3% 74.9% None (many diffs) n/a
5 ccsbBroad304_06635 pLX_304 0% 71.3% 74.9% V5 (many diffs) n/a
6 TRCN0000477265 TACCGAAAATGACCATACATTGCC pLX_317 17.1% 71.3% 74.9% V5 (many diffs) n/a
Download CSV