Transcript: Human NM_198578.4

Homo sapiens leucine rich repeat kinase 2 (LRRK2), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
LRRK2 (120892)
Length:
9239
CDS:
136..7719

Additional Resources:

NCBI RefSeq record:
NM_198578.4
NBCI Gene record:
LRRK2 (120892)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_198578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358257 TAGGCTTACATTAGGTAATTT pLKO_005 960 CDS 100% 15.000 21.000 N LRRK2 n/a
2 TRCN0000358256 TCGAAATGCACTATCATATAT pLKO_005 8182 3UTR 100% 15.000 21.000 N LRRK2 n/a
3 TRCN0000021463 CCCAAATTGGTGGAACTCTTA pLKO.1 2398 CDS 100% 4.950 6.930 N LRRK2 n/a
4 TRCN0000196822 GATAGGACAACTAGTACATTT pLKO.1 8936 3UTR 100% 0.000 0.000 N LRRK2 n/a
5 TRCN0000368513 TCGTCGACTTATACGTGTAAT pLKO_005 7458 CDS 100% 13.200 10.560 N LRRK2 n/a
6 TRCN0000021462 CCACAAATTCAACGGAAAGAA pLKO.1 7052 CDS 100% 5.625 3.938 N LRRK2 n/a
7 TRCN0000021460 CCCAGGATGTTGGAAATGATT pLKO.1 440 CDS 100% 5.625 3.938 N LRRK2 n/a
8 TRCN0000021459 CGTGTGTATGAAGGAATGTTA pLKO.1 7828 3UTR 100% 5.625 3.938 N LRRK2 n/a
9 TRCN0000021461 GCCAGAGGAAATGTCATTTAT pLKO.1 6265 CDS 100% 15.000 9.000 N LRRK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198578.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465878 ACACTGGGATAATCTTGTACGCTG pLX_317 4.4% 99.8% 99.7% V5 (many diffs) n/a
2 ccsbBroadEn_15231 pDONR223 12.5% 97.8% 1.4% None (many diffs) n/a
3 ccsbBroad304_15231 pLX_304 0% 97.8% 1.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV