Transcript: Mouse NM_198647.1

Mus musculus TBC1 domain family, member 22B (Tbc1d22b), mRNA.

Source:
NCBI, updated 2015-02-15
Taxon:
Mus musculus (mouse)
Gene:
Tbc1d22b (381085)
Length:
3505
CDS:
138..1655

Additional Resources:

NCBI RefSeq record:
NM_198647.1
NBCI Gene record:
Tbc1d22b (381085)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_198647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000200095 CGCGTGCATGAGTTGTATGTA pLKO.1 2392 3UTR 100% 5.625 7.875 N Tbc1d22b n/a
2 TRCN0000177058 GCACTCCAAGATATTATGTAT pLKO.1 2710 3UTR 100% 5.625 7.875 N Tbc1d22b n/a
3 TRCN0000197983 CAGTATTATGACTCTCGGAAT pLKO.1 888 CDS 100% 4.050 5.670 N Tbc1d22b n/a
4 TRCN0000219606 GCCAACTACAAGGTCATAAAG pLKO.1 504 CDS 100% 13.200 9.240 N Tbc1d22b n/a
5 TRCN0000243049 GCCAACTACAAGGTCATAAAG pLKO_005 504 CDS 100% 13.200 9.240 N TBC1D22B n/a
6 TRCN0000182616 GTCGTCTTCCTCTCGGAATAT pLKO.1 1095 CDS 100% 13.200 9.240 N Tbc1d22b n/a
7 TRCN0000200454 GCTGGACGGAATACAGGATAA pLKO.1 1211 CDS 100% 10.800 7.560 N Tbc1d22b n/a
8 TRCN0000178723 CTACAGACTCAAGTACATGTT pLKO.1 1604 CDS 100% 4.950 3.465 N Tbc1d22b n/a
9 TRCN0000181603 GCCTTTGTCTTCTCAGTGTAA pLKO.1 3037 3UTR 100% 4.950 3.465 N Tbc1d22b n/a
10 TRCN0000197982 CTTCATCAAAGAAAGGTCGAA pLKO.1 251 CDS 100% 2.640 1.848 N Tbc1d22b n/a
11 TRCN0000198642 CGAGTATGTGTGTGTGTGTAT pLKO.1 2364 3UTR 100% 4.950 2.970 N Tbc1d22b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_198647.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08559 pDONR223 100% 89.5% 98.8% None (many diffs) n/a
2 ccsbBroad304_08559 pLX_304 0% 89.5% 98.8% V5 (many diffs) n/a
3 TRCN0000473893 TAACCTCGGTCATTCTTTGTGCAA pLX_317 30.7% 89.5% 98.8% V5 (many diffs) n/a
Download CSV