Transcript: Human NM_199122.2

Homo sapiens transforming growth factor beta regulator 4 (TBRG4), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-06
Taxon:
Homo sapiens (human)
Gene:
TBRG4 (9238)
Length:
1940
CDS:
135..1700

Additional Resources:

NCBI RefSeq record:
NM_199122.2
NBCI Gene record:
TBRG4 (9238)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146623 CATGACGGTCACTAATGTGT pXPR_003 GGG 667 43% 3 1.2425 TBRG4 TBRG4 77705
2 BRDN0001162363 GAGGGTACCATGCCAGACCG pXPR_003 AGG 421 27% 3 0.3644 TBRG4 TBRG4 77704
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199122.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232665 TCAAGCAGCAATGGTACTTAT pLKO_005 428 CDS 100% 13.200 18.480 N TBRG4 n/a
2 TRCN0000232664 GAGCATCTACTCCCTACATAG pLKO_005 319 CDS 100% 10.800 15.120 N TBRG4 n/a
3 TRCN0000155887 CACATTAGTGACCGTCATGAT pLKO.1 800 CDS 100% 4.950 6.930 N TBRG4 n/a
4 TRCN0000154962 GATGCCCACTTTCATCAACTT pLKO.1 504 CDS 100% 4.950 6.930 N TBRG4 n/a
5 TRCN0000232663 ACTTGCCTGGGTAGCCCATAA pLKO_005 224 CDS 100% 10.800 8.640 N TBRG4 n/a
6 TRCN0000157762 CGAGCATCTACTCCCTACATA pLKO.1 318 CDS 100% 5.625 4.500 N TBRG4 n/a
7 TRCN0000156248 CAGTTCTTCAGCCTGGTACAT pLKO.1 966 CDS 100% 4.950 3.960 N TBRG4 n/a
8 TRCN0000257323 CCTGAATTTCACATCCAATTT pLKO_005 1101 CDS 100% 13.200 9.240 N TBRG4 n/a
9 TRCN0000157725 CATGCGGAAGCTCAAGTACAA pLKO.1 659 CDS 100% 4.950 3.465 N TBRG4 n/a
10 TRCN0000152240 CGTTGGACAGAAATTGAAGAT pLKO.1 774 CDS 100% 4.950 3.465 N TBRG4 n/a
11 TRCN0000154404 GAAGCCAGAAGATAAAGGCTT pLKO.1 473 CDS 100% 0.264 0.185 N TBRG4 n/a
12 TRCN0000232666 GGGTCACCCTTGAGGACAAAC pLKO_005 1764 3UTR 100% 3.600 2.160 N TBRG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199122.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02116 pDONR223 100% 82.5% 82.5% None 733_734ins330 n/a
2 ccsbBroad304_02116 pLX_304 0% 82.5% 82.5% V5 733_734ins330 n/a
3 TRCN0000473807 GGAATGGGAACGTCTCATCCAATT pLX_317 12% 82.5% 82.5% V5 733_734ins330 n/a
Download CSV