Transcript: Human NM_199483.3

Homo sapiens RAB5 interacting factor (RAB5IF), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
RAB5IF (55969)
Length:
939
CDS:
174..605

Additional Resources:

NCBI RefSeq record:
NM_199483.3
NBCI Gene record:
RAB5IF (55969)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155433 CAAAGTCTCCGTCTGGAGTAA pLKO.1 233 CDS 100% 4.950 6.930 N RAB5IF n/a
2 TRCN0000285287 CAAAGTCTCCGTCTGGAGTAA pLKO_005 233 CDS 100% 4.950 6.930 N RAB5IF n/a
3 TRCN0000183748 CCATCAAGTAACAGCTATTAT pLKO.1 680 3UTR 100% 15.000 7.500 Y RAB5IF n/a
4 TRCN0000275129 TTTACACTGCCATCCATTATG pLKO_005 408 CDS 100% 13.200 6.600 Y RAB5IF n/a
5 TRCN0000155232 GCACCTCTGGATTCAGATGAA pLKO.1 731 3UTR 100% 4.950 2.475 Y RAB5IF n/a
6 TRCN0000275128 GCACCTCTGGATTCAGATGAA pLKO_005 731 3UTR 100% 4.950 2.475 Y RAB5IF n/a
7 TRCN0000151946 CCATTTCTTCTTGGATACCAT pLKO.1 663 3UTR 100% 3.000 1.500 Y RAB5IF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199483.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000466507 TTTCTGGTAGCCAAGGGACACTAG pLX_317 90.4% 68.3% 57.1% V5 (many diffs) n/a
2 ccsbBroadEn_03688 pDONR223 100% 67.4% 57.1% None (many diffs) n/a
3 ccsbBroad304_03688 pLX_304 0% 67.4% 57.1% V5 (many diffs) n/a
4 ccsbBroadEn_15919 pDONR223 0% 56.8% 51.7% None (many diffs) n/a
5 ccsbBroad304_15919 pLX_304 0% 56.8% 51.7% V5 (many diffs) n/a
Download CSV