Transcript: Human NM_201436.2

Homo sapiens H2A.Z variant histone 2 (H2AZ2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-07-25
Taxon:
Homo sapiens (human)
Gene:
H2AZ2 (94239)
Length:
1351
CDS:
156..464

Additional Resources:

NCBI RefSeq record:
NM_201436.2
NBCI Gene record:
H2AZ2 (94239)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303449 TGATCCCTCACATCCACAAAT pLKO_005 406 CDS 100% 13.200 10.560 N H2AZ2 n/a
2 TRCN0000303450 TGCTTAGAGGGATGCTTTAAC pLKO_005 458 CDS 100% 13.200 10.560 N H2AZ2 n/a
3 TRCN0000106835 CCTGCCAATTAAATCATGATA pLKO.1 941 3UTR 100% 5.625 4.500 N H2AZ2 n/a
4 TRCN0000303448 ATGATTGATACCATGGTATAT pLKO_005 862 3UTR 100% 13.200 9.240 N H2AZ2 n/a
5 TRCN0000106836 GCTGGCAGGTAATGCTTCTAA pLKO.1 281 CDS 100% 5.625 3.938 N H2AZ2 n/a
6 TRCN0000310400 GCTGGCAGGTAATGCTTCTAA pLKO_005 281 CDS 100% 5.625 3.938 N H2AZ2 n/a
7 TRCN0000106837 TCTCTTATCAAGGCTACCATA pLKO.1 372 CDS 100% 4.950 3.465 N H2AZ2 n/a
8 TRCN0000299143 TCTCTTATCAAGGCTACCATA pLKO_005 372 CDS 100% 4.950 3.465 N H2AZ2 n/a
9 TRCN0000106838 AGGATCTCAAAGTAAAGCGTA pLKO.1 301 CDS 100% 2.640 1.848 N H2AZ2 n/a
10 TRCN0000106839 GATTGGAAAGAAGGGACAGCA pLKO.1 431 CDS 100% 2.640 1.848 N H2AZ2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201436.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04620 pDONR223 100% 79.2% 78.9% None 0_1ins79;2delT n/a
2 ccsbBroad304_04620 pLX_304 0% 79.2% 78.9% V5 (not translated due to frame shift) 0_1ins79;2delT n/a
3 TRCN0000470909 TCCATAAACAGCCGTATAATACCA pLX_317 70.4% 79.2% 78.9% V5 (not translated due to frame shift) 0_1ins79;2delT n/a
4 ccsbBroadEn_00718 pDONR223 100% 64.5% 77.3% None (many diffs) n/a
5 ccsbBroad304_00718 pLX_304 0% 64.5% 77.3% V5 (many diffs) n/a
6 TRCN0000470922 GCGTCATGAGTAACACGTACTCTT pLX_317 84.9% 64.5% 77.3% V5 (many diffs) n/a
Download CSV