Transcript: Mouse NM_201638.2

Mus musculus methyltransferase like 14 (Mettl14), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Mettl14 (210529)
Length:
2625
CDS:
164..1534

Additional Resources:

NCBI RefSeq record:
NM_201638.2
NBCI Gene record:
Mettl14 (210529)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_201638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084993 CCCAGCTTGTACTTTGCTTTA pLKO.1 1585 3UTR 100% 10.800 8.640 N Mettl14 n/a
2 TRCN0000084995 CGGGAAAGAAACCGATCCAAT pLKO.1 1442 CDS 100% 4.950 3.960 N Mettl14 n/a
3 TRCN0000084996 CTATGATACATCTGCTCCAAA pLKO.1 325 CDS 100% 4.950 3.960 N Mettl14 n/a
4 TRCN0000084994 CCCTAAACTTAGGGAACTCAT pLKO.1 601 CDS 100% 0.495 0.396 N Mettl14 n/a
5 TRCN0000084997 GCATTGGTGCTGTGTTAAATA pLKO.1 252 CDS 100% 15.000 10.500 N Mettl14 n/a
6 TRCN0000015937 GCTAATGTTGACATTGACTTA pLKO.1 1082 CDS 100% 4.950 2.970 N METTL14 n/a
7 TRCN0000424895 AGGATGAGTTAATAGCTAAAT pLKO_005 630 CDS 100% 13.200 18.480 N METTL14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201638.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03848 pDONR223 100% 91.2% 98.6% None (many diffs) n/a
2 ccsbBroad304_03848 pLX_304 0% 91.2% 98.6% V5 (many diffs) n/a
3 TRCN0000468454 CATGACGGTATTAGCTCCCTGCCC pLX_317 34% 91.2% 98.6% V5 (many diffs) n/a
Download CSV