Transcript: Human NM_203394.3

Homo sapiens E2F transcription factor 7 (E2F7), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
E2F7 (144455)
Length:
5725
CDS:
226..2961

Additional Resources:

NCBI RefSeq record:
NM_203394.3
NBCI Gene record:
E2F7 (144455)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257286 CTAGCTCGCTATCCAAGTTAT pLKO_005 688 CDS 100% 13.200 18.480 N E2F7 n/a
2 TRCN0000017455 GCAACAGCAAACTCTCTTGTT pLKO.1 2230 CDS 100% 4.950 6.930 N E2F7 n/a
3 TRCN0000235907 CTGCGCTAGACTTGGATATTT pLKO_005 5183 3UTR 100% 15.000 12.000 N E2F7 n/a
4 TRCN0000235905 GCAGTCTCCTGCAGGATTAAA pLKO_005 2352 CDS 100% 15.000 10.500 N E2F7 n/a
5 TRCN0000235906 GTGCTGCCAGCCCAGATATAA pLKO_005 500 CDS 100% 15.000 10.500 N E2F7 n/a
6 TRCN0000017454 CGCATCTATGACATTGTAAAT pLKO.1 778 CDS 100% 13.200 9.240 N E2F7 n/a
7 TRCN0000017456 CGGGTGGCTAAGAATCAGTAT pLKO.1 826 CDS 100% 4.950 3.465 N E2F7 n/a
8 TRCN0000017453 CGCCTCTATGACATAGCCAAT pLKO.1 1225 CDS 100% 4.050 2.835 N E2F7 n/a
9 TRCN0000017457 GCTCTGATAAAGAAAGTGCAT pLKO.1 1261 CDS 100% 2.640 1.848 N E2F7 n/a
10 TRCN0000244407 CTGGACCTGATAGATTATAAA pLKO_005 952 CDS 100% 15.000 9.000 N E2F7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203394.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09611 pDONR223 100% 99.8% 99.7% None 214T>C;969A>G;2721C>A n/a
2 ccsbBroad304_09611 pLX_304 0% 99.8% 99.7% V5 214T>C;969A>G;2721C>A n/a
3 TRCN0000475643 GCAATCGCATACGGTTGTGTTTGA pLX_317 10.9% 99.8% 99.7% V5 214T>C;969A>G;2721C>A n/a
Download CSV