Transcript: Human NM_206839.2

Homo sapiens mortality factor 4 like 1 (MORF4L1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-06-08
Taxon:
Homo sapiens (human)
Gene:
MORF4L1 (10933)
Length:
2011
CDS:
238..1326

Additional Resources:

NCBI RefSeq record:
NM_206839.2
NBCI Gene record:
MORF4L1 (10933)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107582 GTTGCCATAAAGGACAAACAA pLKO.1 334 CDS 100% 5.625 7.875 N MORF4L1 n/a
2 TRCN0000239891 CATGAACAGAGTTGAAGTTAA pLKO_005 804 CDS 100% 13.200 9.240 N Morf4l1b n/a
3 TRCN0000107584 CGGAGAGCAGAGTACTCAAAT pLKO.1 527 CDS 100% 13.200 9.240 N MORF4L1 n/a
4 TRCN0000300138 CGGAGAGCAGAGTACTCAAAT pLKO_005 527 CDS 100% 13.200 9.240 N MORF4L1 n/a
5 TRCN0000107583 GTGTGTAAAGGTTGCCATAAA pLKO.1 324 CDS 100% 13.200 9.240 N MORF4L1 n/a
6 TRCN0000300199 GTGTGTAAAGGTTGCCATAAA pLKO_005 324 CDS 100% 13.200 9.240 N MORF4L1 n/a
7 TRCN0000107581 GCTGAAATTCTTGCAGATCAT pLKO.1 1081 CDS 100% 4.950 3.465 N MORF4L1 n/a
8 TRCN0000300200 GCTGAAATTCTTGCAGATCAT pLKO_005 1081 CDS 100% 4.950 3.465 N MORF4L1 n/a
9 TRCN0000107580 GCTTTGAAGATGTTAGTGTAT pLKO.1 1405 3UTR 100% 4.950 3.465 N MORF4L1 n/a
10 TRCN0000310570 GCTTTGAAGATGTTAGTGTAT pLKO_005 1405 3UTR 100% 4.950 3.465 N MORF4L1 n/a
11 TRCN0000015007 GCTTGTTGATGACTGGGACTT pLKO.1 855 CDS 100% 4.050 2.430 N MORF4 n/a
12 TRCN0000071526 CCTGCCAAGAAGAATGTGGAT pLKO.1 907 CDS 100% 2.640 1.584 N Morf4l1 n/a
13 TRCN0000238603 GGTGTATGGAGCGCCACATTT pLKO_005 1122 CDS 100% 13.200 18.480 N Gm4835 n/a
14 TRCN0000218744 GAAACAGCGAGAACTTCAATA pLKO_005 567 CDS 100% 13.200 9.240 N EG546908 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206839.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02566 pDONR223 100% 89.2% 88.9% None 156_272del n/a
2 ccsbBroad304_02566 pLX_304 0% 89.2% 88.9% V5 156_272del n/a
3 TRCN0000468389 GCTCCCCGGTCGGACCGAAGGCAC pLX_317 38.5% 89.2% 88.9% V5 156_272del n/a
4 ccsbBroadEn_14059 pDONR223 100% 64.8% 64.6% None 1_381del;388G>T n/a
5 ccsbBroad304_14059 pLX_304 0% 64.8% 64.6% V5 1_381del;388G>T n/a
6 ccsbBroadEn_15732 pDONR223 0% 64.8% 64.6% None 1_381del;388G>T n/a
7 ccsbBroad304_15732 pLX_304 0% 64.8% 64.6% V5 1_381del;388G>T n/a
8 TRCN0000472961 ACCCGGTGTCATGCCACGCTAAAA pLX_317 76.3% 64.8% 64.6% V5 1_381del;388G>T n/a
Download CSV