Transcript: Human NM_206918.3

Homo sapiens delta 4-desaturase, sphingolipid 2 (DEGS2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
DEGS2 (123099)
Length:
3834
CDS:
59..1030

Additional Resources:

NCBI RefSeq record:
NM_206918.3
NBCI Gene record:
DEGS2 (123099)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_206918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000064683 CGAGCACTACATGTTCCTCAA pLKO.1 751 CDS 100% 4.050 5.670 N DEGS2 n/a
2 TRCN0000436614 TGTTCTGGGCCTACGCCTTTG pLKO_005 267 CDS 100% 2.000 1.600 N DEGS2 n/a
3 TRCN0000064687 CACGAGACCTACTCCTACTAT pLKO.1 776 CDS 100% 5.625 3.938 N DEGS2 n/a
4 TRCN0000064685 CTCAACTGGATCACCTTCAAT pLKO.1 803 CDS 100% 5.625 3.938 N DEGS2 n/a
5 TRCN0000064684 CAGCCCTTCTTCTACTCACTA pLKO.1 554 CDS 100% 4.950 3.465 N DEGS2 n/a
6 TRCN0000436229 ATCCACGACATCTCGCACAAC pLKO_005 320 CDS 100% 4.050 2.835 N DEGS2 n/a
7 TRCN0000433397 CAAGAAGTACCACGTGGACCA pLKO_005 430 CDS 100% 2.160 1.512 N DEGS2 n/a
8 TRCN0000064686 GCGCAAGGAGATACTGGCCAA pLKO.1 124 CDS 100% 0.720 0.504 N DEGS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_206918.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09476 pDONR223 100% 99.7% 99.6% None 169G>A;465A>G n/a
2 ccsbBroad304_09476 pLX_304 0% 99.7% 99.6% V5 169G>A;465A>G n/a
3 TRCN0000477175 TAGTTTTCAAACACCGATGGCATA pLX_317 37% 99.7% 99.6% V5 169G>A;465A>G n/a
Download CSV