Transcript: Human NM_207390.3

Homo sapiens C-type lectin domain containing 17A (CLEC17A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-02-23
Taxon:
Homo sapiens (human)
Gene:
CLEC17A (388512)
Length:
2052
CDS:
78..998

Additional Resources:

NCBI RefSeq record:
NM_207390.3
NBCI Gene record:
CLEC17A (388512)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_207390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119133 GCGAACAAATATGACTGGCAT pLKO.1 713 CDS 100% 2.640 3.696 N CLEC17A n/a
2 TRCN0000119135 GATTAAGTACCAGGAGTTGAT pLKO.1 653 CDS 100% 4.950 3.465 N CLEC17A n/a
3 TRCN0000119132 GCTTCCCAAATTGTGAGGATT pLKO.1 1682 3UTR 100% 4.950 3.465 N CLEC17A n/a
4 TRCN0000119136 CCTGATTAAGTACCAGGAGTT pLKO.1 650 CDS 100% 4.050 2.835 N CLEC17A n/a
5 TRCN0000119134 TGAGAACTCAACACCTCCCTA pLKO.1 155 CDS 100% 2.640 1.848 N CLEC17A n/a
6 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 1827 3UTR 100% 5.625 2.813 Y KLHL30 n/a
7 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 1827 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_207390.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15319 pDONR223 89.3% 80.8% 21.3% None 195_196insC;894_895ins110;918_919ins106 n/a
2 ccsbBroad304_15319 pLX_304 0% 80.8% 21.3% V5 (not translated due to prior stop codon) 195_196insC;894_895ins110;918_919ins106 n/a
3 TRCN0000477061 TTCACCCTGAAACTCTCCTACTGA pLX_317 32.9% 80.8% 21.3% V5 (not translated due to prior stop codon) 195_196insC;894_895ins110;918_919ins106 n/a
Download CSV