Transcript: Human NR_002201.1

Homo sapiens ferritin heavy chain 1 pseudogene 3 (FTH1P3), non-coding RNA.

Source:
NCBI, updated 2019-02-03
Taxon:
Homo sapiens (human)
Gene:
FTH1P3 (2498)
Length:
954
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002201.1
NBCI Gene record:
FTH1P3 (2498)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000029431 CCAAATACTTTCTTCACCAAT pLKO.1 367 3UTR 100% 4.950 2.475 Y FTH1 n/a
2 TRCN0000029433 GCCGAATCTTCCTTCAGGATA pLKO.1 445 3UTR 100% 4.950 2.475 Y FTH1 n/a
3 TRCN0000029430 GCTTTGAAGAACTTTGCCAAA pLKO.1 351 3UTR 100% 4.050 2.025 Y FTH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002201.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06225 pDONR223 100% 55% None (many diffs) n/a
2 ccsbBroad304_06225 pLX_304 0% 55% V5 (many diffs) n/a
3 TRCN0000474651 AGGTACCGAGCAGATTTAACCCTA pLX_317 60.2% 55% V5 (many diffs) n/a
4 ccsbBroadEn_10224 pDONR223 100% 32.3% None 1_119del;429_954del n/a
5 ccsbBroad304_10224 pLX_304 0% 32.3% V5 1_119del;429_954del n/a
6 TRCN0000470474 GTTGTTAATTAATCCACACCCTTG pLX_317 100% 32.3% V5 1_119del;429_954del n/a
Download CSV