Transcript: Human NR_002451.2

Homo sapiens ATP binding cassette subfamily A member 11, pseudogene (ABCA11P), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
ABCA11P (79963)
Length:
1895
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_002451.2
NBCI Gene record:
ABCA11P (79963)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_002451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000136860 CACGAAGTAGAGGAACTCATA pLKO.1 419 3UTR 100% 4.950 3.465 N ABCA11P n/a
2 TRCN0000138224 CATACCAATCCAGAAGAGCCT pLKO.1 436 3UTR 100% 0.660 0.462 N ABCA11P n/a
3 TRCN0000135466 GAAGAAGATGTTCAAGCTGAA pLKO.1 457 3UTR 100% 4.050 2.430 N ABCA11P n/a
4 TRCN0000138900 GAGAACTCACTGTGTCCCAAA pLKO.1 807 3UTR 100% 4.050 2.430 N ABCA11P n/a
5 TRCN0000136742 GAAAGAGTCCAAGCAGCAAAT pLKO.1 475 3UTR 100% 10.800 5.400 Y ABCA11P n/a
6 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 243 3UTR 100% 5.625 2.813 Y ZNF765 n/a
7 TRCN0000136292 GCAGGAAAGATATTCCTCTTT pLKO.1 1324 3UTR 100% 0.495 0.248 Y ABCA11P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_002451.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10254 pDONR223 100% 10.4% None 1_1046del;1245_1895del n/a
2 ccsbBroad304_10254 pLX_304 0% 10.4% V5 1_1046del;1245_1895del n/a
3 TRCN0000466929 AAAGATGGGCGAAGTCCGGCACCA pLX_317 100% 10.4% V5 1_1046del;1245_1895del n/a
Download CSV