Transcript: Human NR_003554.1

Homo sapiens ubiquitin specific peptidase 32 pseudogene 2 (USP32P2), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
USP32P2 (220594)
Length:
4859
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003554.1
NBCI Gene record:
USP32P2 (220594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011158 CACTGCTTTAGCAACAAAGAA pLKO.1 1720 3UTR 100% 5.625 3.375 N USP32P2 n/a
2 TRCN0000230368 ACCTGGACATGTCCCATTAAA pLKO_005 4395 3UTR 100% 15.000 7.500 Y USP6 n/a
3 TRCN0000011161 CCAAAGAGAAGACACTCATAT pLKO.1 2434 3UTR 100% 13.200 6.600 Y USP32P2 n/a
4 TRCN0000011157 CCCAGACATTAGGAGTTCATA pLKO.1 3790 3UTR 100% 5.625 2.813 Y USP32P2 n/a
5 TRCN0000011159 GCACAATTTCTGCCAAAGATT pLKO.1 2651 3UTR 100% 5.625 2.813 Y USP32P2 n/a
6 TRCN0000007335 CCCTGCAAGTTGATTCTCATT pLKO.1 4097 3UTR 100% 4.950 2.475 Y USP6 n/a
7 TRCN0000011160 CCTTCCTGATTATTCACCTTA pLKO.1 1764 3UTR 100% 4.950 2.475 Y USP32P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003554.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13327 pDONR223 100% 4.2% None (many diffs) n/a
2 ccsbBroad304_13327 pLX_304 0% 4.2% V5 (many diffs) n/a
3 TRCN0000476448 GTATAATACAGCTCGGATCTAGCC pLX_317 100% 4.2% V5 (many diffs) n/a
Download CSV