Transcript: Human NR_003671.2

Homo sapiens chromosome X open reading frame 56 pseudogene (LOC728024), non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
LOC728024 (728024)
Length:
1503
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003671.2
NBCI Gene record:
LOC728024 (728024)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268325 ACCAATCCCAGCCGAAGAATG pLKO_005 347 3UTR 100% 10.800 6.480 N C330007P06Rik n/a
2 TRCN0000167207 CTTGATTGACAACCAGTTCAA pLKO.1 687 3UTR 100% 4.950 2.475 Y CXorf56 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08818 pDONR223 100% 43.1% None (many diffs) n/a
2 ccsbBroad304_08818 pLX_304 0% 43.1% V5 (many diffs) n/a
3 TRCN0000480783 GGCGCCCTCACTTTTCACATATCA pLX_317 59.9% 43.1% V5 (many diffs) n/a
Download CSV