Transcript: Human NR_003950.1

Homo sapiens zinc finger DHHC-type containing 8 pseudogene 1 (ZDHHC8P1), non-coding RNA.

Source:
NCBI, updated 2018-05-25
Taxon:
Homo sapiens (human)
Gene:
ZDHHC8P1 (150244)
Length:
2548
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003950.1
NBCI Gene record:
ZDHHC8P1 (150244)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000203915 CTGTCCTACAATAATGTGCTC pLKO.1 668 3UTR 100% 2.160 3.024 N ZDHHC8P1 n/a
2 TRCN0000204238 CCTTGAGACCTGGCATTTCTT pLKO.1 2048 3UTR 100% 5.625 4.500 N ZDHHC8P1 n/a
3 TRCN0000160861 GACCTGGCATTTCTTTGATAA pLKO.1 2054 3UTR 100% 13.200 9.240 N ZDHHC8P1 n/a
4 TRCN0000162608 CCTGGCATTTCTTTGATAACA pLKO.1 2056 3UTR 100% 5.625 3.938 N ZDHHC8P1 n/a
5 TRCN0000185196 CCTTTGCTTGTAGATAAGATT pLKO.1 2162 3UTR 100% 5.625 3.938 N ZDHHC8P1 n/a
6 TRCN0000204686 GTGCTACAGCTCTACAGATGA pLKO.1 1045 3UTR 100% 4.950 3.465 N ZDHHC8P1 n/a
7 TRCN0000166745 CAGACATCATTGTCCTCGCTT pLKO.1 1112 3UTR 100% 2.640 1.848 N ZDHHC8P1 n/a
8 TRCN0000166159 CGTTTCCTGCTCATTCTGGAA pLKO.1 2085 3UTR 100% 2.640 1.848 N ZDHHC8P1 n/a
9 TRCN0000140719 GATCACTTGAGGTCAGGAGTT pLKO.1 2296 3UTR 100% 4.050 2.025 Y P3H4 n/a
10 TRCN0000165299 GATCACTTGAGGTCAGGAGTT pLKO.1 2296 3UTR 100% 4.050 2.025 Y ORAI2 n/a
11 TRCN0000352971 GATCACTTGAGGTCAGGAGTT pLKO_005 2296 3UTR 100% 4.050 2.025 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003950.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13261 pDONR223 100% 12.6% None (many diffs) n/a
2 ccsbBroad304_13261 pLX_304 0% 12.6% V5 (many diffs) n/a
3 TRCN0000491604 GCGTCTCGTGCTCTTGGCTTGCGG pLX_317 98.3% 12.6% V5 (many diffs) n/a
Download CSV