Transcript: Human NR_024248.1

Homo sapiens tumor suppressing subtransferable candidate 2 pseudogene (TSSC2), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
TSSC2 (650368)
Length:
1477
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024248.1
NBCI Gene record:
TSSC2 (650368)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000036016 CCTCATCCACCAGAAGCATTT pLKO.1 643 3UTR 100% 10.800 5.400 Y LOC402458 n/a
2 TRCN0000035128 AGCTGGTGAAACATGAAGAAA pLKO.1 947 3UTR 100% 5.625 2.813 Y ALG1L6P n/a
3 TRCN0000035983 ACTGACTCTTGATGGACACAA pLKO.1 562 3UTR 100% 4.950 2.475 Y LOC401305 n/a
4 TRCN0000035693 CCCTTTGGTTATGGACACATA pLKO.1 1125 3UTR 100% 4.950 2.475 Y ALG1 n/a
5 TRCN0000035858 GCTAAACCAGTTCCGGAAGAA pLKO.1 1050 3UTR 100% 4.950 2.475 Y ALG1L9P n/a
6 TRCN0000035125 CCAGAAGCATTTCCAGCACAT pLKO.1 652 3UTR 100% 4.050 2.025 Y ALG1L6P n/a
7 TRCN0000036015 AGAGGACGAAGACTTCTCCAT pLKO.1 512 3UTR 100% 2.640 1.320 Y LOC402458 n/a
8 TRCN0000035126 CGTCTGTGTGATAACAGGCAA pLKO.1 595 3UTR 100% 2.640 1.320 Y ALG1L6P n/a
9 TRCN0000110364 CAAGCCAGCATCTTTCTTTAA pLKO.1 306 3UTR 100% 13.200 7.920 N Alg1 n/a
10 TRCN0000035873 CAGGGCAAATCCTTTCGAGTA pLKO.1 1213 3UTR 100% 4.050 2.430 N LOC285544 n/a
11 TRCN0000035857 CAGAGGACGAAGACTTCTCTA pLKO.1 511 3UTR 100% 4.950 2.475 Y ALG1L9P n/a
12 TRCN0000035979 CCTTCCTTCTCTCGTCTGTAT pLKO.1 583 3UTR 100% 4.950 2.475 Y LOC401305 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08617 pDONR223 100% 48% None (many diffs) n/a
2 ccsbBroad304_08617 pLX_304 0% 48% V5 (many diffs) n/a
3 TRCN0000474781 GTTGTCATAGGATTGTCCTTGGGT pLX_317 41.7% 48% V5 (many diffs) n/a
4 ccsbBroadEn_09808 pDONR223 100% 36.4% None (many diffs) n/a
5 ccsbBroad304_09808 pLX_304 0% 36.4% V5 (many diffs) n/a
6 TRCN0000473899 GTAAGTGAACCTTCGCATAACGTG pLX_317 73.6% 36.4% V5 (many diffs) n/a
Download CSV