Transcript: Human NR_024251.1

Homo sapiens family with sequence similarity 86 member J, pseudogene (FAM86JP), transcript variant 1, non-coding RNA.

Source:
NCBI, updated 2018-05-24
Taxon:
Homo sapiens (human)
Gene:
FAM86JP (100125556)
Length:
2068
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_024251.1
NBCI Gene record:
FAM86JP (100125556)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_024251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000172901 GCCAGCAGTTCTGGTTCTTAA pLKO.1 801 3UTR 100% 13.200 6.600 Y EEF2KMT n/a
2 TRCN0000128827 GCTTTCTCTCAGAACTCATCA pLKO.1 336 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
3 TRCN0000129161 GTGCTTTCTCTCAGAACTCAT pLKO.1 334 3UTR 100% 4.950 2.475 Y FAM86B1 n/a
4 TRCN0000130496 GACCAGAAACTGTTTCCCTAT pLKO.1 550 3UTR 100% 4.050 2.025 Y FAM86B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_024251.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03547 pDONR223 100% 17.2% None (many diffs) n/a
2 ccsbBroad304_03547 pLX_304 0% 17.2% V5 (many diffs) n/a
3 TRCN0000473048 AGTGCATTTCATCTCTGTAGCAAC pLX_317 92.4% 17.2% V5 (many diffs) n/a
4 ccsbBroadEn_12901 pDONR223 100% 6.7% None (many diffs) n/a
5 ccsbBroad304_12901 pLX_304 0% 6.7% V5 (many diffs) n/a
6 TRCN0000465314 AGCCAGTACTCTATTCCGAAGGCA pLX_317 100% 6.7% V5 (many diffs) n/a
Download CSV