Transcript: Human NR_026667.1

Homo sapiens ribosomal protein S10 pseudogene 7 (RPS10P7), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
RPS10P7 (376693)
Length:
699
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026667.1
NBCI Gene record:
RPS10P7 (376693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000074810 CTGGAGACATTTCTACTGGTA pLKO.1 339 3UTR 100% 2.640 1.320 Y RPS10 n/a
2 TRCN0000298184 CTGGAGACATTTCTACTGGTA pLKO_005 339 3UTR 100% 2.640 1.320 Y RPS10 n/a
3 TRCN0000298564 CAAGTCCCGAGGCTACGTGAA pLKO_005 308 3UTR 100% 1.350 0.675 Y RPS10 n/a
4 TRCN0000074811 GTACCTTACCAATGAGGGTAT pLKO.1 357 3UTR 100% 0.000 0.000 Y RPS10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026667.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01450 pDONR223 100% 66.9% None (many diffs) n/a
2 ccsbBroad304_01450 pLX_304 0% 66.9% V5 (many diffs) n/a
3 TRCN0000471438 ATCTAGGGTCGCGATTGTGGTTTG pLX_317 96.1% 66.9% V5 (many diffs) n/a
4 ccsbBroadEn_10362 pDONR223 100% 30.9% None 1_152del;369_699del n/a
5 ccsbBroad304_10362 pLX_304 0% 30.9% V5 1_152del;369_699del n/a
6 TRCN0000467822 CGCCTCGGACTAACTGACTCCGAT pLX_317 100% 30.9% V5 1_152del;369_699del n/a
Download CSV