Transcript: Human NR_026846.1

Homo sapiens anaphase promoting complex subunit 1 pseudogene (LOC285074), non-coding RNA.

Source:
NCBI, updated 2018-05-12
Taxon:
Homo sapiens (human)
Gene:
LOC285074 (285074)
Length:
2225
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026846.1
NBCI Gene record:
LOC285074 (285074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000167787 GCTTTGGCTATGATCTACTTA pLKO.1 1934 3UTR 100% 5.625 2.813 Y LOC285074 n/a
2 TRCN0000167232 CTGAATTATCAGGGACACTTT pLKO.1 505 3UTR 100% 4.950 2.475 Y LOC285074 n/a
3 TRCN0000033913 GCTGAATTATCAGGGACACTT pLKO.1 504 3UTR 100% 4.950 2.475 Y RMND5A n/a
4 TRCN0000168792 GCTGAATTATCAGGGACACTT pLKO.1 504 3UTR 100% 4.950 2.475 Y LOC285074 n/a
5 TRCN0000168732 GATGCTGAATTATCAGGGACA pLKO.1 501 3UTR 100% 2.160 1.080 Y LOC285074 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026846.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10606 pDONR223 100% 13.1% None 1_353del;526G>C;648_2225del n/a
2 ccsbBroad304_10606 pLX_304 0% 13.1% V5 1_353del;526G>C;648_2225del n/a
3 TRCN0000468732 CCTAGCCGATCCCTCCAAGAATAT pLX_317 100% 13.1% V5 1_353del;526G>C;648_2225del n/a
Download CSV