Transcript: Human NR_026893.3

Homo sapiens POU class 6 homeobox 1 (POU6F1), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2019-01-08
Taxon:
Homo sapiens (human)
Gene:
POU6F1 (5463)
Length:
5526
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_026893.3
NBCI Gene record:
POU6F1 (5463)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_026893.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310938 ATGCTCAGGGACAGGTTATTG pLKO_005 1341 3UTR 100% 13.200 9.240 N Pou6f1 n/a
2 TRCN0000017970 CCTCTGCTCCTATCCCAATTA pLKO.1 1641 3UTR 100% 13.200 9.240 N POU6F1 n/a
3 TRCN0000017969 CGGGAGTTTGCCAAGAACTTT pLKO.1 1751 3UTR 100% 5.625 3.938 N POU6F1 n/a
4 TRCN0000017971 CTTCGCATTTAGCCCAGGAAT pLKO.1 1204 3UTR 100% 4.950 3.465 N POU6F1 n/a
5 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4322 3UTR 100% 13.200 6.600 Y IQCC n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 4420 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_026893.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01248 pDONR223 100% 16.3% None 1_1309del;2213_5526del n/a
2 ccsbBroad304_01248 pLX_304 0% 16.3% V5 1_1309del;2213_5526del n/a
3 TRCN0000476325 GTCACTGTTAGTTGAGAACCACAG pLX_317 41.9% 16.3% V5 1_1309del;2213_5526del n/a
Download CSV