Transcript: Human NR_027094.1

Homo sapiens synaptotagmin 14 pseudogene 1 (SYT14P1), non-coding RNA.

Source:
NCBI, updated 2018-06-03
Taxon:
Homo sapiens (human)
Gene:
SYT14P1 (401135)
Length:
2628
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027094.1
NBCI Gene record:
SYT14P1 (401135)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000180747 GCGGCCAAATCCAGTATACAA pLKO.1 522 3UTR 100% 5.625 3.938 N SYT14P1 n/a
2 TRCN0000147270 GAAATTCTCATTAGCCTGCTT pLKO.1 343 3UTR 100% 2.640 1.848 N SYT14P1 n/a
3 TRCN0000183037 CAAGGAACAATTCACAAGATA pLKO.1 229 3UTR 100% 5.625 3.375 N SYT14P1 n/a
4 TRCN0000147941 GAGATGTCCAAATGCAAGATA pLKO.1 487 3UTR 100% 5.625 2.813 Y SYT14P1 n/a
5 TRCN0000147682 GACTATCAGCAGAAGTGATAA pLKO.1 383 3UTR 100% 1.320 0.660 Y SYT14P1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027094.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10630 pDONR223 100% 21.4% None 1_189del;276C>T;754_2628del n/a
2 ccsbBroad304_10630 pLX_304 0% 21.4% V5 1_189del;276C>T;754_2628del n/a
3 TRCN0000481038 GTGACAGGGAACAATCAAACCCAA pLX_317 71% 21.4% V5 1_189del;276C>T;754_2628del n/a
4 ccsbBroadEn_10376 pDONR223 100% 17.8% None 1_285del;754_2628del n/a
5 ccsbBroad304_10376 pLX_304 0% 17.8% V5 1_285del;754_2628del n/a
6 TRCN0000476481 CTTCGTTGAAACCCAACGGCGATA pLX_317 82.6% 17.8% V5 1_285del;754_2628del n/a
Download CSV