Transcript: Human NR_027141.2

Homo sapiens DENND10 pseudogene 1 (DENND10P1), non-coding RNA.

Source:
NCBI, updated 2019-06-16
Taxon:
Homo sapiens (human)
Gene:
DENND10P1 (55855)
Length:
2508
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027141.2
NBCI Gene record:
DENND10P1 (55855)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121908 CGAAGTGCTATAACTACTTTA pLKO.1 1513 3UTR 100% 13.200 6.600 Y DENND10P1 n/a
2 TRCN0000138293 CTTCCACGACAGCCACATTAA pLKO.1 316 3UTR 100% 13.200 6.600 Y DENND10 n/a
3 TRCN0000142359 GTTCTGTGGGTGTGGTGTTAT pLKO.1 294 3UTR 100% 13.200 6.600 Y DENND10P1 n/a
4 TRCN0000136571 CCTTAATTTGGAGGCGCTAAA pLKO.1 1196 3UTR 100% 10.800 5.400 Y DENND10 n/a
5 TRCN0000215338 CTCCATCAAAGACATTGTATC pLKO.1 689 3UTR 100% 10.800 5.400 Y Fam45a n/a
6 TRCN0000137434 GCAGTTGCACTTTCTCGTAAA pLKO.1 1794 3UTR 100% 10.800 5.400 Y DENND10 n/a
7 TRCN0000136868 CCAGACCTCTATGATGTGTTT pLKO.1 954 3UTR 100% 4.950 2.475 Y DENND10 n/a
8 TRCN0000143696 GACTGATAGAAAGCCCTCTTT pLKO.1 1318 3UTR 100% 4.950 2.475 Y DENND10P1 n/a
9 TRCN0000141962 GCAATGGGCAAACTGCACAAA pLKO.1 1029 3UTR 100% 4.950 2.475 Y DENND10P1 n/a
10 TRCN0000137239 GCAGAGAGTGAGATTACCATT pLKO.1 984 3UTR 100% 4.950 2.475 Y DENND10 n/a
11 TRCN0000141718 GCTGGCTCCATCAAAGACATT pLKO.1 684 3UTR 100% 4.950 2.475 Y DENND10P1 n/a
12 TRCN0000142920 CACAAAGAAATGGGTCAGCTA pLKO.1 1044 3UTR 100% 2.640 1.320 Y DENND10P1 n/a
13 TRCN0000142335 CGCTGGATTTGTAGACTTGGA pLKO.1 920 3UTR 100% 2.640 1.320 Y DENND10P1 n/a
14 TRCN0000193953 GTGTTTGTGAATCTGGCAGAT pLKO.1 969 3UTR 100% 4.050 2.025 Y Fam45a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027141.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08599 pDONR223 100% 42.6% None 1_218del;1037C>T;1290_2508del n/a
2 ccsbBroad304_08599 pLX_304 0% 42.6% V5 1_218del;1037C>T;1290_2508del n/a
3 TRCN0000475565 CGACCGCATCACTAATATAACCAG pLX_317 27.7% 42.6% V5 1_218del;1037C>T;1290_2508del n/a
4 ccsbBroadEn_05655 pDONR223 100% 42.5% None (many diffs) n/a
5 ccsbBroad304_05655 pLX_304 0% 42.5% V5 (many diffs) n/a
6 TRCN0000471589 AGATGCAGCGCCACAGGGAATCAA pLX_317 33.1% 42.5% V5 (many diffs) n/a
Download CSV