Transcript: Human NR_027297.1

Homo sapiens homer scaffold protein 3 (HOMER3), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-02-06
Taxon:
Homo sapiens (human)
Gene:
HOMER3 (9454)
Length:
1991
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027297.1
NBCI Gene record:
HOMER3 (9454)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152619 GAACAGCATCTGACACAGTTT pLKO.1 939 3UTR 100% 4.950 6.930 N HOMER3 n/a
2 TRCN0000446700 GCGCACGTGTTCCAAATTGAC pLKO_005 693 3UTR 100% 4.950 6.930 N HOMER3 n/a
3 TRCN0000153533 CGGCTAAAGAAGATGTTGTCT pLKO.1 1161 3UTR 100% 3.000 4.200 N HOMER3 n/a
4 TRCN0000155724 CAAACCAAGGACCAGGAGATT pLKO.1 1446 3UTR 100% 4.950 3.465 N HOMER3 n/a
5 TRCN0000154879 CCATCATCAACAGCACTGTCA pLKO.1 826 3UTR 100% 2.640 1.848 N HOMER3 n/a
6 TRCN0000150673 GCTAAAGAAGATGTTGTCTGA pLKO.1 1163 3UTR 100% 2.640 1.848 N HOMER3 n/a
7 TRCN0000447164 TTTCGCACTGCAGGACAGCAA pLKO_005 1220 3UTR 100% 2.640 1.848 N HOMER3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027297.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07419 pDONR223 100% 54.2% None (many diffs) n/a
2 ccsbBroad304_07419 pLX_304 0% 54.2% V5 (many diffs) n/a
3 TRCN0000466726 TAACCCTGGTTTCTATGGAAATCC pLX_317 35% 54.2% V5 (many diffs) n/a
4 TRCN0000488613 GGCTTTGTTGAGCTCAAATGATTG pLX_317 34.8% 54.2% V5 (many diffs) n/a
5 TRCN0000488500 TGGACTCCAATTTAGTCCCTGTTC pLX_317 24.9% 54.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV