Transcript: Human NR_027437.3

Homo sapiens inositol hexakisphosphate kinase 2 (IP6K2), transcript variant 7, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
IP6K2 (51447)
Length:
1321
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_027437.3
NBCI Gene record:
IP6K2 (51447)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_027437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315337 CCCTGCTGAGATGCGCAAATT pLKO_005 360 3UTR 100% 13.200 9.240 N IP6K2 n/a
2 TRCN0000202175 CAATGAGACAACCCTGTGCAA pLKO.1 300 3UTR 100% 2.640 1.848 N Ip6k2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_027437.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000465932 GCCTATCAGACCGAAGTTGTCGTT pLX_317 100% 22.4% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15841 pDONR223 0% 22% None 1_195del;396_526del;618_1321del n/a
3 ccsbBroad304_15841 pLX_304 0% 22% V5 1_195del;396_526del;618_1321del n/a
4 ccsbBroadEn_15842 pDONR223 0% 15.8% None 1_195del;406_1321del n/a
5 ccsbBroad304_15842 pLX_304 0% 15.8% V5 1_195del;406_1321del n/a
6 TRCN0000492194 ATCCTCCCCCCGGAGATAATCTAT pLX_317 100% 15.8% V5 (not translated due to prior stop codon) 1_195del;406_1321del n/a
Download CSV